The largest database of trusted experimental protocols

Universal sybr green fast qpcr mix kit

Manufactured by ABclonal

The 2X Universal SYBR Green Fast qPCR Mix kit is a reagent designed for quantitative real-time PCR (qPCR) analysis. It contains a 2X concentrated master mix with SYBR Green I dye, which enables the detection and quantification of DNA targets.

Automatically generated - may contain errors

2 protocols using universal sybr green fast qpcr mix kit

1

Quantitative RT-PCR for Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from cultured cells using TRIzol reagent (AG21101, Accurate Biology, China), according to the manufacturer's instructions. RNA was reverse-transcribed using the ABScript II cDNA First-Strand Synthesis Kit (RK20400, ABclonal, Wuhan, China) to generate first-strand cDNA. qRT-PCR experiments were performed using DNA Engine Opticon 2 (MJ Research, Watertown, MA, USA). 2X Universal SYBR Green Fast qPCR Mix kit (RK21203; ABclonal, Wuhan, China) was used for PCRs. The following primers were used: GAPDH forward 5′-CAGTGCCAGCCTCGTCCCGTAGA-3′ and reverse 5′-CTGCAAATGGCAGCCCTGGTGAC-3′; MSRB1 forward 5′-GACGTTACACCCTCACCTT-3′ and reverse 5′-AGCTACTTCCGCACAGATT-3′. The 2−ΔΔCt method was used to analyze the mRNA expression levels of target genes in the control and experimental groups.
+ Open protocol
+ Expand
2

Gene Expression Analysis of Inflammatory Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using MagicZol reagent and reverse transcribed using the 5X All-In-One RT MasterMix kit (G490, abm). Besides, 2X Universal SYBR Green Fast qPCR Mix kit (RK21204, ABclonal) was used for quantitative real-time PCR. Also, β-actin was used as an internal control and 2ΔΔCt was applied to calculate the relative expression of the target gene. The analyzed genes and the primer sequences are listed in Table 1.

Primer sequences used for the qPCR analysis

GeneForward Primer (5ʹ‑3ʹ)Reverse Primer (5ʹ‑3ʹ)
β-actinGGCTGTATTCCCCTCCATCGCCAGTTGGTAACAATGCCATGT
Sirt6ATGTCGGTGAATTATGCAGCAGCTGGAGGACTGCCACATTA
Ptp1bGGAACTGGGCGGCTATTTACCCAAAAGGGCTGACATCTCGGT
LeprTGGTCCCAGCAGCTATGGTACCCAGAGAAGTTAGCACTGT
Pi3kACACCACGGTTTGGACTATGGGGCTACAGTAGTGGGCTTGG
Jak2TTGTGGTATTACGCCTGTGTATCATGCCTGGTTGACTCGTCTAT
Socs3ATGGTCACCCACAGCAAGTTTTCCAGTAGAATCCGCTCTCCT
Tnf-αCCCTCACACTCAGATCATCTTCTGCTACGACGTGGGCTACAG
Il-6TAGTCCTTCCTACCCCAATTTCCTTGGTCCTTAGCCACTCCTTC
Il-1βGCAACTGTTCCTGAACTCAACTATCTTTTGGGGTCCGTCAACT
Cd16CAGAATGCACACTCTGGAAGCGGGTCCCTTCGCACATCAG
Cd86TGTTTCCGTGGAGACGCAAGTTGAGCCTTTGTAAATGGGCA
Ym1/2CAGGGTAATGAGTGGGTTGGCACGGCACCTCCTAAATTGT
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!