Mir 140 5p mimic

Recombinant lentiviruses targeting H19 (shH19-1 and shH19-2) and Lenti-shNC were purchased from GenePharma Company (Shanghai, China). hDPSCs were transfected by lentiviruses exposure in 1 mL α-MEM supplemented with 10% FBS and 5 μg/mL polybrene for 24 h. H19 overexpression plasmid pcDNA3.1-H19, miR-140-5p mimics, and scramble control (NC) were chemically synthesized by GenePharma. When hDPSCs were 70–80% confluent, pcDNA-H19 and miRNA mimic transfection was performed using Lipofectamine 3000 (Invitrogen, USA) according to the manufacturer’s instructions. qRT-PCR analysis was used to detect H19 and miR-140-5p expression levels to validate the transfection efficiencies. The cells were cultured in mineralizing medium for odontoblastic differentiation 48 h after transfection.

The lncRNA AK002107‐knockdown vector, miR‐140‐5p inhibitor, and miR‐140‐5p mimics were obtained from GenePharma (Shanghai, China). For the packaging of the construct, 293T cells were transfected with shAK002107/NC and pPACKH1 Packaging Plasmid Mix, and after 3 days, the virus particles were collected with the Lenti‐Concentin Virus Precipitation Solution according to the SBI packaging protocol. Cells were infected with the TransDux virus transduction reagent. Positively infected cells were selected with puromycin. LipoiMAX transfection reagent (Invitrogen) was used to transfect the miR‐140‐5p inhibitor according to the manufacturer's recommended protocol. Forty‐eight hours after transfection, cells were collected and used in subsequent experiments. The following shRNA sequences were used:
shAK002107‐1: 5′‐TGATACTCAGCACTAGACTAACTTCAAGAGAGTTAGTCTAGTGCTGAGTATC‐TTTTT‐3′ and shAK002107‐2: 5′‐TGCATAGCTAATCCTGTTAAAGTTCAAGAGACTTTAACAGGATTAGCTATGC‐TTTTT‐3′.

For cell transfection, negative control, TGFBR1 siRNA, miR-140-5p mimics, miR-140-5p inhibitor, TGFBR1-expressing vectors, and their respective negative controls (Shanghai GenePharma, China) were diluted with OptiMEM I medium at a selected optimal concentration and then transfected into HK2 cells with Lipofectamine 2000 (Invitrogen). The cells were collected 48 h after the transfection.

A normal cell line hFOB 1.19 [CBP60724; Culture Medium: Dulbecco's modified Eagle's medium (DMEM): F12 + 0.3 mg·mL⁻¹ G418 + 10% FBS) was cultured with 5% CO₂ at 34 °C as described previously (Bozycki et al., 2018) and five cell lines related to osteosarcoma: U2OS (CBP60238; Culture Medium: McCoy's 5a + 10% FBS), SaOS‐2 (CBP60742; Culture Medium: McCoy's 5a + 15% FBS), MG63 (CBP60233; Culture Medium: MEM + 10% FBS), HOS (CBP60787; Culture Medium: RPMI‐1640 Medium + 10% FBS), and SJSA1 (CBP60236; Culture Medium: RPMI‐1640 + 10% FBS), which were purchased from Cobioer Biotechnology Co., Ltd. (Nanjing, China) and cultured with 5% CO₂ at 37 °C. The medium was renewed every day.
Osteosarcoma cells were plated into 6‐well plates (3 × 10⁵ cells/well). Upon attaining 50% cell confluence, short hairpin RNA (sh)‐negative control (NC), sh‐PGM5‐AS1‐1, sh‐PGM5‐AS1‐2, overexpression (oe)‐NC, oe‐PGM5‐AS1, inhibitor NC, miR‐140‐5p inhibitor, mimic NC, miR‐140‐5p mimic, or sh‐FBN1 was delivered into the cells following the procedures in the Lipofectamine 2000 kit (11668‐019; Invitrogen, Carlsbad, CA, USA). The mimic NC, miR‐140‐5p mimic, inhibitor NC, and miR‐140‐5p inhibitor, and plasmids were purchased from Shanghai GenePharma Co., Ltd. (Shanghai, China). Table 1 displays the sequences of shRNAs.