The transfected cells were sorted and harvested for DNA and RNA isolation, respectively. Genome DNA was extracted from cells with a standard salting-out procedure. Total RNA was isolated from cells by using Tripure isolation reagent (Roche, USA). Genome DNA and total RNA concentration were determined using ultraviolet spectrophotometer DU800 (Beckman), and RNA concentration was normalized to 200 ng/μL. Then, total RNA was converted into cDNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche, USA). PCR primers used for HBe DNA amplification were as follows: HBe sense: 5′-ATGGACATTGACCCGTATAAAG-3′; HBe anti-sense: 5′-CTAACATTGAGATTCCCGAGATTG-3′. Reverse transcription PCR primers used for HBe cDNA amplification were as follows: HBe sense: 5′-CTA TTC TGT GTT GGG GTG AG-3′; HBe anti-sense: 5′-AAG TAA GGC AGG AAA TGT GA-3′. In detail, 50 ng genome DNA or 1 μL cDNA was amplified as template in 20 μL PCR system containing 1 mM dNTP, 0.2 mM MgCl2, 500 nM primer, and 0.5 U Taq polymerase. Cycling was carried out in a 9700 thermal cycler (PE Applied Bio systems) under the following conditions: 5 min at 95°C, 33 cycles of 95°C for 30 sec, 60°C for 30 sec, and 72°C for 45 sec, followed by a final extension step for 7 min at 72°C. The PCR system without DNA was set as negative control. PCR products were analyzed by 1.5% ethidium bromide–agarose gel electrophoresis.
9700 thermal cycler
Manufactured by Thermo Fisher Scientific
Sourced in United States, United Kingdom
The 9700 Thermal Cycler is a laboratory instrument designed for the amplification of DNA samples. It provides precise temperature control and automated cycling for the Polymerase Chain Reaction (PCR) process, which is a fundamental technique in molecular biology, genetics, and diagnostics.
Automatically generated - may contain errors
Lab products found in correlation
Hd polymerase, by Takara Bio (4 mentions)
Abi prism 3730xl dna analyzer, by Thermo Fisher Scientific (3 mentions)
Abi prism big dye terminator cycle sequencing ready reaction kit v 3, by Thermo Fisher Scientific (3 mentions)
Pcr fragment extraction kit, by Geneaid (3 mentions)
Kapa hifi hotstart pcr kit, by Roche (3 mentions)
Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (3 mentions)
3130 genetic analyzer, by Thermo Fisher Scientific (3 mentions)
Abi prism 3130xl genetic analyzer, by Thermo Fisher Scientific (3 mentions)
Bigdye terminator cycle sequencing ready reaction kit, by Thermo Fisher Scientific (3 mentions)
Pcr buffer, by Takara Bio (2 mentions)
Magna pure compact nucleic acid isolation kit, by Roche (2 mentions)
Qiaamp dna blood mini kit, by Qiagen (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Qiaquick pcr purification kit, by Qiagen (2 mentions)
Taqman assay, by Thermo Fisher Scientific (2 mentions)
7900ht sequence detection system, by Thermo Fisher Scientific (2 mentions)
Sds v2, by Thermo Fisher Scientific (2 mentions)
Wizard genomic dna purification kit, by Promega (2 mentions)
Du800, by Beckman Coulter (1 mentions)
Tripure isolation reagent, by Roche (1 mentions)
55 protocols using 9700 thermal cycler
1
Hepatitis B Virus DNA and RNA Analysis
2
Genotyping of TNF-α Polymorphisms
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The −308 TNF-α polymorphism was analyzed according to the Wilson's protocol with modifications (24 (link)). PCR mixture (25 μl) contained 100 ng genomic DNA and PCR buffer (ADS Biotec, USA), dNTPs mixture (0.25 mM), Optimase polymerase (ADS Biotec, USA), and primers (10 μM of each). The mixture underwent touchdown PCR including 95°C for 2 min and 7 cycles of amplification: denaturation 95°C for 30 s, annealing 66°C for 30 (−1°C per cycle), elongation 72°C for 20 s; followed by 30 cycles with denaturation 95°C for 30 s, annealing 59°C for 30, elongation 72°C for 20 s. The final elongation took 3 min at 72°C. The PCR reaction was performed in an Eppendorf Mastercycler.
The −238 TNF-α polymorphism was characterized by PCR-RFLP (25 (link)). Each PCR mixture (25 μl) contained 100 ng genomic DNA and PCR buffer (Clontech Laboratories, USA), dNTPs mixture (0,25 mM), HD polymerase (Clontech Laboratories, USA) and primers (10 μM of each). The mixture was heated in 94°C for 4 min and underwent 35 cycles of amplification: denaturation 98°C for 20 s, annealing 61°C for 20 s, elongation 72°C for 25 s. The final elongation took 3 min at 72°C. The PCR reaction was performed in an Applied Biosystems 9700 Thermal Cycler.
The −238 TNF-α polymorphism was characterized by PCR-RFLP (25 (link)). Each PCR mixture (25 μl) contained 100 ng genomic DNA and PCR buffer (Clontech Laboratories, USA), dNTPs mixture (0,25 mM), HD polymerase (Clontech Laboratories, USA) and primers (10 μM of each). The mixture was heated in 94°C for 4 min and underwent 35 cycles of amplification: denaturation 98°C for 20 s, annealing 61°C for 20 s, elongation 72°C for 25 s. The final elongation took 3 min at 72°C. The PCR reaction was performed in an Applied Biosystems 9700 Thermal Cycler.
3
Molecular Identification of Yeast M. persimmonesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Polymerase chain reaction amplification of 18S rDNA was performed in a final reaction volume of 30 μl using 30 pmol of the universal solvent-based primers ITS1 (5′-TCC GTA GGT GAA CCT GCG G-3′; sequence ID: 3) and ITS4 (5′-TCC TCC GCT TAT TGA TAT GC-3′; sequence ID: 4), 20 ng genomic DNA, and Solg 2× Taq PCR Pre-Mix (Solgent, Daejeon, Korea). The reaction was carried out in a 9700 thermal cycler (Applied Biosystems, Singapore) under the following conditions: 95 °C for 15 min; 35 cycles of 50 °C for 40 s, 50 °C for 40 s, and 72 °C for 90 s; and 72 °C for 5 min. A 10-μl volume of the amplified 18S rDNA product was visualized by 1.5% agarose gel electrophoresis and was observed as a 600-bp band under ultraviolet light. The DNA fragment was purified using a kit (Solgent) and inserted into the pGEM-Teasy vector (Promega, Madison, WI, USA), which was transformed into XL1-Blue MRF competent cells (Stratagene, La Jolla, CA, USA). Single colonies were selected for insert verification. T7 and SP6 primer sites were analyzed with an ABI3730 automatic DNA sequencer (Applied Biosystems, Foster City, CA, USA) and compared with sequences in the National Center for Biotechnology Information (NCBI) Genbank database (http://www.ncbi.nlm.nih.gov ). The GenBank Accession Number for the 18s rDNA and 26s rDNA of the yeast M. persimmonesis was MF446617 and MF446618 respectively.
4
EGFR Mutation Detection Workflow
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted by using the MagNA Pure Compact Nucleic Acid Isolation Kit on the MagNA Pure Compact System (Roche, Pleasanton, CA, USA). The primers used were EGFR-C797-F: CATTCATGCGTCTTCACCTG and EGFR-C797-R: TTATCTCCCCTCCCCGTATC. The target sequences were amplified by a KAPA HiFiHotStart PCR kit (KAPA Biosystems, Pleasanton, CA, USA). The reaction mixtures were run in a 9700 thermal cycler (Applied Biosystems) using the following cycling reactions: 3 min at 95 °C, followed by 25 cycles of 20 s at 95 °C, 20 s at 66 °C, and 30 s at 72 °C, with a final hold at 4 °C. The PCR amplicons were checked by 1.5% agarose gel electrophoresis. The amplicons were purified by using a PCR Fragment Extraction Kit (Geneaid, Taiwan). DNA sequencing was performed using the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit v3.1 (Applied Biosystems) and the ABI PRISM 3730XL DNA Analyzer.
5
HLA Genotyping by Sequence-Based Typing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from peripheral blood using the QIAamp Blood Mini Kit (QIAGEN, Hilden, Germany) or dried blood spots on paper (FTA Mini Card; Whatman, Florham Park, NJ, USA). Sequence-based typing of HLA-A, -B, and -C was performed with pairs of amplification and sequencing primers, as described previously [17 (link)]. PCR was carried out in a 30-μL reaction volume that consisted of 100 ng genomic DNA, 1× PCR buffer, 0.2 mmol/L dNTPs, 0.4 mmol/L primers, 2.5 mmol/L MgCl2, 1× Band Doctor, and 1 U EF Taq polymerase (Solgent, Deajeon, Korea). PCR was performed using a 9700 Thermal Cycler (Applied Biosystems, Foster City, CA, USA) with the following conditions: initial denaturation at 95°C for 2 min, followed by 30 cycles of 95°C for 30 s, 62–67°C for 40 s, 72°C for 1 min 40 s, and a final elongation step at 72°C for 5 min. The entire PCR product was sequenced directly using a 3130 DNA Sequencer (Applied Biosystems). HLA-A, -B, and -C genotypes were determined by analysis of sequencing data using the SBT Engine software (ver. 2.20; GenDx, Utrecht, the Netherlands).
6
Constructing pre-miRNA expression vectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pre-miRNA expression vectors were constructed by amplifying a ~0.5-kb DNA fragment encompassing the pre-miRNA region using the human genomic DNA (heterozygous for the variant of interest) as a template. Using PfuUltra high-fidelity DNA polymerase (Agilent, Santa Clara, CA, USA), PCR reactions were performed with the designed primers (Supplementary Table S2 ) by an Applied Biosystems 9700 Thermal cycler with annealing and elongation temperatures of 58°C and 72°C. The amplified fragments were purified with PCR purification kit (Qiagen) and analyzed on 1.5% agarose gels. The resulting fragments were cloned into a lentiviral vector (pCDH-CMV-EF1-Puro-GFP) using XbaI and BamHI or NheI and BamHI restriction enzymes (Supplementary Table S2 ). The plasmids that contained the wild-type or mutant miRNA genes were identified by Sanger sequencing.
7
CTAB-based DNA Extraction and SSR Marker Analysis in Soybean
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA was extracted from trifoliolate leaves of the parents and the F2 population by the CTAB method (Murray and Thompson 1980 (link)). A total of 94 F2 plants were randomly selected and used for analysis, because PCR reaction plates and the electrophoresis apparatus were designed for multiples of 96 samples (94 F2 plants and two parents). SSR markers developed by USDA (Song et al. 2004 (link)) or by the Kazusa DNA Research Institute (Hisano et al. 2007 (link)) were used for screening of polymorphisms between the parents. The PCR mixture contained 20 ng of genomic DNA, 2.25 pmol of primer, 625 pmol of nucleotides, and 0.125 unit of ExTaq in 1 × ExTaq Buffer supplied by the manufacturer (Takara Bio, Ohtsu, Japan) in a total volume of 5 μL. An initial 4 min denaturation at 95°C was followed by 35 cycles of 1 min denaturation at 95°C, 1 min annealing at 49°C, and 1 min extension at 68°C. PCR was performed in an Applied Biosystems 9700 thermal cycler (Applied Biosystems, Foster City, CA). PCR products were separated in 8% nondenaturing acrylamide gels, and the fragments were visualized by staining with ethidium bromide. To investigate the possibility of outcrossing, SSR marker genotypes of Harosoy-E5 (5 markers for each MLG) were compared with Harosoy (recurrent parent) and PI 80837 (donor parent).
8
Genotyping SLCO1B1 and ABCG2 Variants
9
Multiplex PCR for Genomic DNA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the multiplex PCR each reaction mixture (25 μl) contained 100 ng genomic DNA and PCR buffer (Clontech Laboratories, USA), dNTPs mixture (0,25 mM), HD polymerase (Clontech Laboratories, USA) and primers (10 μM of each). The method used was by Abdel-Rahman et al. with minor modifications (23 (link)). The mixture was heated in 94°C for 5 min and underwent 35 cycles of amplification: denaturation 94°C for 2 min, annealing 59°C for 1 min, and elongation 72°C for 1 min. The final elongation took 10 min at 72°C. The PCR reaction was performed in an Applied Biosystems 9700 Thermal Cycler.
10
Quantifying miR-31-3p Expression in FFPE
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MiR-31-3p expression was quantified using FFPE-extracted RNAs via RT followed by real-time qPCR. Reverse transcription reactions contained 30 ng of total RNA including either the miRNA or different quantities of the reference standard (see above), stem-loop RT primer miR-31-3p/miR-calibrator, RT buffer, 0.25 mM of each deoxynucleotide (dNTP) Solution Mix, 3.33 U/µL of MultiScribe Reverse Transcriptase (Applied Biosystems, Foster City, CA, USA), and 0.25 U/µL of the ribonuclease inhibitor from the TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems). The 15-µL reactions were incubated in an 9700 Thermal Cycler (Applied Biosystems) or SimpliAMP Thermal Cycler (Applied Biosystems) for 30 minutes at 16°C, 30 minutes at 42°C, 5 minutes at 85°C, and then held at 4°C.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!