Stem loop–specific RT for miRNA in soybean, L. japonicus and M. sativa was performed as described previously (40 (link)). MiR1520d was used as an internal control of miRNA in soybean (40 (link)). U6s were used as internal controls of miRNA in L. japonicus and M. sativa (47 (link)). Quantitative reverse transcription PCR (qRT-PCR) was conducted using a Hieff qPCR SYBR Green Master Mix kit (Yeasen Biotech) with the gene-specific primers listed in table S1.
Hieff qpcr sybr green master mix kit
The Hieff qPCR SYBR Green Master Mix kit is a ready-to-use solution for quantitative real-time PCR analysis. It contains all the necessary components, including SYBR Green I dye, DNA polymerase, and reaction buffers, to perform gene expression studies and other qPCR applications.
Lab products found in correlation
33 protocols using hieff qpcr sybr green master mix kit
Quantifying Gene and miRNA Expression in Plants
Stem loop–specific RT for miRNA in soybean, L. japonicus and M. sativa was performed as described previously (40 (link)). MiR1520d was used as an internal control of miRNA in soybean (40 (link)). U6s were used as internal controls of miRNA in L. japonicus and M. sativa (47 (link)). Quantitative reverse transcription PCR (qRT-PCR) was conducted using a Hieff qPCR SYBR Green Master Mix kit (Yeasen Biotech) with the gene-specific primers listed in table S1.
Quantitative Analysis of Osteoclast Markers
RT-qPCR for LncRNA Expression
Quantitative Analysis of Gene Expression
Quantitative Expression Analysis via qRT-PCR
Validation of RNA-seq Differential Expression
RT-qPCR Analysis of lncRNA-FMR6 and SAV1
Primer sequences used for real-time PCR analysis
Genes | Primers (5′-3′) |
---|---|
lncRNA-FMR6 | Forward: AGCACTTCAGGGCAGATTTT |
Reverse: TGGTGAATGATCACCCAATG | |
SAV1 | Forward: ATGAGGCGTGAAAGCAACAG |
Reverse: CCGCTGTGCTCATAGTATCTGTA | |
GAPDH | Forward: GTCAACGGATTTGGTCTGTATT |
Reverse: AGTCTTCTGGGTGGCAGTGAT |
Quantitative Gene Expression Analysis in Huh7 Cells
Investigating Retinal Gene Expression in Albino Guinea Pigs
Total RNA Extraction and qRT-PCR Analysis
The qRT-PCR was performed on a QuantStudio 5 Real-Time PCR System (Applied Biosystems, Foster City, USA) using a Hieff qPCR SYBR Green Master Mix kit (Yeasen, Shanghai, China). The qRT-PCR reaction was performed 95 °C for 5 min, followed by 40 cycles of 95 °C for 10 s and a primer-specific annealing temperature of 60 °C for 30 s. The qRT-PCR primer sequences were provided in Table
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!