Viral RNAs were extracted from 200 μl of allantoic fluids of infected eggs using the MagNA Pure Total Nucleic Acid Kit (Roche) and the MagNa Pure LC 2.0 Robot (Roche). RNA was eluted in a final volume of 50 μl. SuperScriptTMIII One-Step HiFi System (Invitrogen) was used to produce RT-PCR products of all genes except for the HA (previously determined by the HI assay) for pyrosequencing. Primers were used at a final concentration of 0.4 μM. The RT-PCR conditions were 50°C for 30 minutes, denaturation at 94°C for 2 minutes, followed by 45 cycles of 94°C for 15 seconds, annealing 55°C for 30 seconds, 68°C for 1 minute. The RT-PCR products were examined on a 96-well, 2% agarose E-gel (Invitrogen) to confirm amplification of an appropriately sized DNA band. A negative control (water) was used to determine the level of background associated with the primers. Nucleotide dispensations for the pyrosequencing assay were customized to improve the detection of strain-specific nucleotide differences [39] (link). The modified dispensation CCATTGCAAGCCAATGCCAATGCATG was used for all genes of influenza A (H3N2) influenza viruses. The dispensation orders for influenza A (H7N9) genes were as follows: NA, TACTATGCACTGCAGTC ; NS, CGATCTAGATG ; M, ATATCGCTCGTTA ; NP, CTACTAGATGACATGA ; PA, GTAGGACTCTGATAGC ; PB1, AGTACGACAGTCTGTG PB2, GTGACAGATCTCTC .
Magna pure total nucleic acid kit
Manufactured by Roche
Sourced in Switzerland, Germany
The MagNA Pure Total Nucleic Acid Kit is a laboratory equipment product designed for the automated extraction and purification of total nucleic acids, including DNA and RNA, from a variety of biological samples. The kit utilizes magnetic bead-based technology to capture and isolate the nucleic acids, providing a reliable and efficient method for nucleic acid isolation.
Automatically generated - may contain errors
Lab products found in correlation
7 protocols using magna pure total nucleic acid kit
1
Pyrosequencing-based Influenza Virus Genotyping
2
HBV/HCV Molecular Detection in Donor Samples
3
Influenza Virus RNA Isolation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from influenza virus-containing allantoic fluids and purified on the MagnaPure LC (Roche, San Francisco, CA) using the MagNA Pure Total Nucleic Acid Kit (Roche) following the manufacturer’s instructions. Clarified allantoic fluid of infected eggs (200 μL) was used for RNA isolation. RNA was eluted in a final volume of 50 μL of water.
4
SARS-CoV-2 RT-PCR Detection Protocol
5
Multiplex Viral and Bacterial Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The specimens had been collected using swabs and were immediately placed in a sterile container with 1 ml of sodium chloride solution and sent to the CM either the same day or stored at +4°C until transport. At CM, specimens were analyzed directly upon arrival at the laboratory.
Total nucleic acid, including RNA, was extracted from all samples using MagnaPure Total Nucleic Acid kit (Roche, Basel, Switzerland).
In the routine analysis, a multiplex‐panel real‐time quantitative PCR (qPCR) system was used, an updated version of the one described in reference [17 (link)]. The panel included 16 viruses (influenzavirus A, influenzavirus B, human respirovirus 1 and 3, human rubulavirus 2, human metapneumovirus, respiratory syncytial virus, EV, adenovirus, human coronaviruses [229E, OC43, NL63, HKU1], and bocavirus) and three bacteria (Mycoplasma pneumoniae, Bordertella species, and Chlamydia pneumoniae).
Two PCR systems were used for the identification of EVs. One system was designed to identify most types belonging to EV A–D and the other to identify RV A. Primers and probes are described in TableS1 . Due to the high sequence similarity between some EV A–D and RV A–C types, these viruses are difficult to distinguish by qPCR. Members belonging to EV‐A–D may thus react with the system designed for RV A–C and vice versa. The two systems together are, however, specific for all types of EVs.
Total nucleic acid, including RNA, was extracted from all samples using MagnaPure Total Nucleic Acid kit (Roche, Basel, Switzerland).
In the routine analysis, a multiplex‐panel real‐time quantitative PCR (qPCR) system was used, an updated version of the one described in reference [17 (link)]. The panel included 16 viruses (influenzavirus A, influenzavirus B, human respirovirus 1 and 3, human rubulavirus 2, human metapneumovirus, respiratory syncytial virus, EV, adenovirus, human coronaviruses [229E, OC43, NL63, HKU1], and bocavirus) and three bacteria (Mycoplasma pneumoniae, Bordertella species, and Chlamydia pneumoniae).
Two PCR systems were used for the identification of EVs. One system was designed to identify most types belonging to EV A–D and the other to identify RV A. Primers and probes are described in Table
6
Real-time RT-PCR for RVFV Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A RVFV real-time RT-PCR (27 (link)) was used for the detection of RVFV in serum samples that were recovered on the day of challenge and 3, 6, 9, 14, and 21 dpc.
Total nucleic acid was extracted from serum samples using the MagNA Pure Total Nucleic Acid Kit (High Performance) (Roche, Switzerland). The real-time RT-PCR assay was performed using the LC 480 One-step RNA Master kit (Roche, Switzerland), as per the manufacturer's instructions. The following primers and probe were used: RVS (Forward): 5′- AAA GGA ACA ATG GAC TCT GGT CA−3′; RVA (Reverse): 5′- CAC TTC TTA CTA CCA TGT CCT CCA AT−3′; RVP (Probe): 5′ –FAM- AAA GCT TTG ATA TCT CTC AGT GCC CCA A –BHQ−3′. The real-time RT-PCR reaction mix and the cycling conditions are listed inSupplementary Material 2 .
Total nucleic acid was extracted from serum samples using the MagNA Pure Total Nucleic Acid Kit (High Performance) (Roche, Switzerland). The real-time RT-PCR assay was performed using the LC 480 One-step RNA Master kit (Roche, Switzerland), as per the manufacturer's instructions. The following primers and probe were used: RVS (Forward): 5′- AAA GGA ACA ATG GAC TCT GGT CA−3′; RVA (Reverse): 5′- CAC TTC TTA CTA CCA TGT CCT CCA AT−3′; RVP (Probe): 5′ –FAM- AAA GCT TTG ATA TCT CTC AGT GCC CCA A –BHQ−3′. The real-time RT-PCR reaction mix and the cycling conditions are listed in
7
Quantitative RT-PCR for Influenza A
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nucleic extractions were performed on 50 µL BAL fluid obtained after sacrifice using the Roche MagNA Pure Total Nucleic Acid Kit on a MagNA Pure 96 instrument (Roche Diagnostics, Penzberg, Germany). A semiquantitative reverse transaiption‐polymerase chain reaction was performed with the LightCycler 480 (Roche Diagnostics, Penzberg, Germany), using a validated protocol for influenza A.29 Cycle threshold (Ct) values above 40 were considered negative; viral load estimates were calculated based on Ct values.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!