The qRT-PCR was performed as described previously by Chiu et al. [24 (link)]. Briefly, a TRIzol kit (Life Technologies, Carlsbad, CA, USA) and an ABI StepOne™ Real-Time PCR system and StepOne 2.1 software (Applied Biosystems, Foster City, CA, USA) were used to perform total RNA extraction and qRT-PCR analysis. The 0.5–1 μg total RNA extracted from skeletal muscle tissues was converted into complementary DNA (cDNA) by avian myeloblastosis virus reverse transcriptase, and then the amplification of cDNA was determined by real-time SYBR Green PCR reagent (Life Technologies, Carlsbad, CA, USA) with specific primers: GAPDH (as a reference gene) (forward: CTGGAGAAACCTGCCAAGTATGAT; reverse: TTCTTACTCCTTGGAGGCCAGTA), lipoprotein lipase (LPL) (forward: GCAGGAAGTCTGACCAACAAG; reverse: CTTCACCAGCTGGTCCACAT). The relative quantification of gene expression was determined by the comparative threshold cycle method (ΔΔCT) in which the expression level of each target gene was normalized to the levels of GAPDH. 2−ΔΔCT was used to express as fold changes of mRNA expression levels relative to the HF group.
Stepone 2
Manufactured by Thermo Fisher Scientific
Sourced in United States
The StepOne 2.1 software is a tool designed for the analysis and interpretation of data generated by real-time PCR instruments. It provides a user-friendly interface for setting up and running experiments, as well as analyzing the resulting data.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (5 mentions)
Stepone real time pcr system, by Thermo Fisher Scientific (4 mentions)
Revertra ace qpcr rt kit, by Toyobo (4 mentions)
Aceq qpcr sybr green master mix, by Vazyme (4 mentions)
Trizol kit, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Vazyme (2 mentions)
Taqman technology, by Thermo Fisher Scientific (2 mentions)
Actb hs99999903 m1, by Thermo Fisher Scientific (2 mentions)
Rneasy kit, by Qiagen (2 mentions)
Nanodrop 1000, by Thermo Fisher Scientific (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Abi stepone real time pcr system, by Thermo Fisher Scientific (1 mentions)
Rneasy ffpe kit, by Qiagen (1 mentions)
Ready mix mixture, by Merck Group (1 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr reagent, by Thermo Fisher Scientific (1 mentions)
Taqman real time pcr, by Thermo Fisher Scientific (1 mentions)
Gapdh, by Thermo Fisher Scientific (1 mentions)
22 protocols using stepone 2
1
Skeletal Muscle qRT-PCR Analysis
2
Quantitative gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA of cell and tissue samples was extracted using Trizol reagent (Vazyme, R401‐01) in strict accordance with the instructions. Then, cDNA was performed using a ReverTra Ace® qPCR RT kit (Toyobo). Real‐time quantitative polymerase chain reaction (qPCR) was processed on a StepOne Real‐Time PCR system (Applied Biosystems) with AceQ® qPCR SYBR® Green Master Mix (Vazyme). Detailed sequences of primer used for qPCR are shown in Table S1 . The expression level of detected genes in each sample was normalized to the expression level of actin mRNA. The data were analyzed using StepOne 2.1 software (Applied Biosystems) in strict accordance with the instructions.
3
Quantitative PCR Analysis of Murine Reproductive Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mice testicular and ovarian RNAs were isolated and quantified [29 (link)]. In each run, 20 ng of cDNA were used per reaction. The primers used were as follows: mouse inhibitor of differentiation 4 (ID4) forward 5′ AGGGTGACAGCATTCTCTGC 3′; mouse ID4 reverse 5′ CCGGTGGCTTGTTTCTCTTA 3′; mouse GNDF family receptor alpha-1 (GFRA1) forward 5′ GCGTGTGAAGCACTGAAGTC 3′; mouse GFRA1 reverse 5′ GGTTCAGTTCCGACCCAAC 3′; mouse spermatogenesis- and oogenesis-specific basic helix-loop-helix transcription factor 2 (SOHLH2) forward 5′ TCTCAGCCACATCACAGAGG 3′; mouse SOHLH2 reverse 5′ GGGGACGCGAGTCTTATACA 3′; mouse newborn ovary homeobox gene (NOBOX) forward 5′ CATGAAGGGGACCTGAAGAA 3′; mouse NOBOX reverse 5′ GGAAATCTCATGGCGTTTGT 3′; mouse factor in the germline alpha (FIGLA) forward 5′ ACAGAGCAGGAAGCCCAGTA 3′; mouse FIGLA reverse 5′ TGGGTAGCATTTCCCAAGAG 3′. The house-keeping gene selected for the qPCR calibration was hypoxanthine-guanine phosphoribosyl transferase (HPRT1) and the primers used were as follows: HPRT1 forward 5′ CTCATGGACTGATTATGGACAGGAC 3′; mouse HPRT1 reverse 5′ GCAGGTCAGCAAAGAACTTATAGCC 3′. Data was recorded and analyzed by StepOne 2.1 software (Applied biosystems, ThermoFisher Scientific, USA).
4
Ovarian mRNA Expression Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Purification of total RNA from formalin fixed, paraffin-embedded microdissected ovarian tissue was made by RNeasy-FFPE kit according to the manufacturer’s instructions (QIAGEN GmbH, Hilden, Germany). Ovarian mRNA was quantified [21 (link)]; first-strand cDNA was created by RT (Applied biosystems, Foster City, California) in 35 cycles with 0.4 μM gene-specific primers using ready-mix mixture (Sigma). mRNA amount were assessed by SYBR green reagent (SYBR Green PCR Master Mix, ABI, Carlsbad, CA, USA) on an ABI Prism 7900 Sequence PCR machine. In each run, 20 ng of cDNA per reaction were used as an amplification template. The house-keeping gene selected for the qPCR calibration was hypoxanthine-guanine phosphoribosyltransferase (HPRT1). The primers used were as follows: human HPRT1 forward 5’ TGA CAC TGG CAA AAC AAT GCA 3’; human HPRT1 reverse 5’ GGT CCT TTT CAC CAG CAA GCT 3’; human Protein kinase B (AKT) forward 5’ ACG TGG CTA TTG TGA AGG AG 3’; human AKT reverse 5’ CAT TCT TGA GGA GGA AGT AGC G 3’; human AMH forward 5’ CAG TTG CTA GTC CTA CAT CTG GCT GA 3’; human AMH reverse 5’ GGA AGT CCA CGG TTA GCA CCA AAT 3’. Data was recorded and analyzed by StepOne 2.1 software (Applied biosystems).
5
Quantitative Real-Time PCR of Total RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from A549 and H1299 cells with TRIzol reagent (Invitrogen, United States) according to the manufacturer’s instructions. cDNA for quantitative real-time PCR (qRT-PCR) was generated using a ReverTra Ace® qPCR RT Kit (Toyobo). qRT-PCR was performed using a AceQ® qPCR SYBR® Green Master Mix (Vazyme, China) in a 96-well format following the manufacturer’s instructions. Primers were listed in Supplementary Table S1 . Data were analyzed by StepOne 2.1 software (Applied Biosystems, United States) according to the manufacturer’s specifications. β-Actin was used as a control.
6
Liver Gene Expression Analysis by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extraction and qRT-PCR analysis were determined by using a TRIzol kit (Life Technologies, Carlsbad, CA, USA), an ABI StepOne™ Real-Time PCR system, and StepOne 2.1 software (Applied Biosystems, Foster City, CA, USA) as described previously by Chiu et al. (2017) [34 (link)]. Briefly, the real-time SYBR Green PCR reagent (Life Technologies, Carlsbad, CA, USA) was used to amplify the complementary DNA (cDNA), which was converted from the total RNAs (0.5–1 μg) extracted from liver tissues by avian myeloblastosis virus reverse transcriptase. The specific primers used are as follows: LDLR (forward: TGCTACTGGCCAAGGACAT; reverse: CTGGGTGGTCGGTACAGTG), CYP7A1 (forward: CTGCAACCTTTTGGAGCTTATT; reverse: GCACTCTGTAAAGCTCCACTC), and GAPDH (forward: CTGGAGAAACCTGCCAAGTATGAT; reverse: TTCTTACTCCTTGGAGGCCAGTA). An internal control GAPDH was used. The comparative threshold cycle method (ΔΔCt) was used to determine the relative quantification of gene expressions. The levels of mRNA expressions were normalized by the GAPDH level. The fold changes of mRNA levels compared to the HF group were expressed as 2−ΔΔCt.
7
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of cells was extracted using a TRIzol reagent (Vazyme, China), cDNA for quantitative real-time PCR (qRT-PCR) was synthesized from 1 μg of RNA by a ReverTra Ace® qPCR RT Kit (Toyobo, Japan). qRT-PCR was performed using an AceQ® qPCR SYBR® Green Master Mix (Vazyme, China) in a 96-well format according to the manufacturer's instructions. Primers were listed in Supplementary Table S1 . β-Actin was used as a control. Data were analyzed with the StepOne 2.1 software (Applied Biosystems, USA) following the manufacturer's specifications.
8
RNA Isolation, cDNA Synthesis, and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated with TRIzol reagent (Invitrogen), and cDNA was generated using a ReverTra Ace® qPCR RT kit (Toyobo). Real-time quantitative polymerase chain reaction (qPCR) was performed with the primers listed in Supplementary Table 2 . Real-time qPCR was performed on a StepOne Real-Time PCR system (Applied Biosystems, USA) with AceQ® qPCR SYBR® Green Master Mix (Vazyme, China). Data were analysed by StepOne 2.1 software (Applied Biosystems, USA) according to the manufacturer’s specifications. β-Actin was used as a control.
9
Real-Time PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RA-FLS (samples 5-10) were cultured in six-well plates at a density of 2x106 cells/well with 1,000 ng/ml of FasL or serum-free medium only as a control. RNA was extracted using the QIAshredder and RNeasy mini kits according to the manufacturer's protocols. Oligo (dT)-primed first-strand complementary DNA (cDNA) was synthesized (2 µg total RNA) using a High Capacity cDNA Transcription kit (Applied Biosystems; Thermo Fisher Scientific). Relative expression levels of mRNA encoding DUSP6, EREG, IL-11, ANGPTL7, PIAS2, and GDF5 were compared using TaqMan® real-time PCR on a StepOne™ real-time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). Pre-designed primers and probes for DUSP6 (Hs04329643_s1), EREG (Hs00914313_m1), IL-11 (Hs01055413_g1), ANGPTL7 (Hs00221727_m1), PIAS2 (Hs00915227_m1), GDF5 (Hs00167060_m1), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Hs99999905_m1) were obtained from Applied Biosystems (Thermo Fisher Scientific, Inc.). Comparative analysis of each of these genes in individual patients was performed using StepOne™ 2.1 software (Applied Biosystems; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. All amplifications were conducted in duplicate. The mRNA expression levels of each gene were calculated using the comparative threshold cycle (ΔΔCq) method as previously described (30 (link)).
10
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with TRIzol reagent (Invitrogen, USA) following the manufacturer's instructions.
Quantitative real-time PCR was performed using reverse transcription kit (Takara, Japan) and SYBR Green PCR Master Mix (Roche, Germany). The primers were listed in Supplementary Table S1. Data were analyzed by StepOne 2.1 software (Applied Biosystems, USA) according to the manufacturer's speci cations, and were normalized using β-actin.
Quantitative real-time PCR was performed using reverse transcription kit (Takara, Japan) and SYBR Green PCR Master Mix (Roche, Germany). The primers were listed in Supplementary Table S1. Data were analyzed by StepOne 2.1 software (Applied Biosystems, USA) according to the manufacturer's speci cations, and were normalized using β-actin.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!