Q5 kit

A human UBQLN4 cDNA clone was obtained from GE Dharmacon (Clone ID: 6183942, Accession #BU149502). The coding region was excised and 5’Fse1 and 3’Asc1 sites were inserted via PCR (UBQLN4 FseFwd 5’ GATC GGC CGG CCT ACC ATG GCG GAG CCG AGC GGG GCC GAG 3’; UBQLN4 AscRev 5’ GAT CGG CGC GCC TTA GGA GAG CTG GGA GCC CAG CAG 3’). The product was ligated into a pCS2-Flag vector, and site-directed mutagenesis (Q5 kit, NEB) was performed to convert the 2747 adenine to cytosine (UBQLN4 Q5 Fwd 5’ AAG GCT CAA GcT CCA GCT GCT G 3’; UBQLN4 Q5 Rev 5’ CTG AGG GGT CTT GAT GAC 3’). Both wild-type and mutant constructs were verified by sequencing. Ub^G76V-GFP was a gift from Nico Dantuma (Addgene plasmid #11941).

Elements were amplified from genomic DNA using primers in the flanking sequence and Phusion HSII (Thermo Scientific). Orangutan DNA was obtained from the Gene Bank of Primates at the German Primate Center. Primer sequences are provided in Additional file 2: Table S6. To facilitate melting of the VNTR, the denaturation time was extended to 30s and 3% DMSO was added to the reaction mix. Amplicons were subcloned into pJET 1.2 (Thermo Scientific) and sequenced. To obtain complete VNTR sequences, subclones containing the VNTR 5′ and 3′ ends, respectively, were generated using SmaI (H8_43) or MscI (OU3, OU4). 5′ primers localized directly upstream of the CT hexameric repeats and 3′ primers designed to exclude the elements’ polyadenylation signals were used for re-amplification. KpnI and NheI recognition sites, respectively, were introduced into the upstream and downstream re-amplification primers. Amplicons were again subcloned into pJET 1.2, sequenced and transferred into pCEP Neo [12 (link)] and pCEP_mneoM via KpnI/NheI. The human SVA H8_43 displays an 11 bp deletion in the SINE-R region when compared to SVA_E and to the subgroup consensus sequences. To obtain a plasmid with a consensus SVA_E SINE-R for cross-species comparison, the missing 11 bp were introduced by site-directed mutagenesis (NEB Q5 kit).

The sequence for a 5xGS linker was added to the C terminus of the gB gene, followed by a 6xHis tag in the pEP98 plasmid. The gene for VSV-G (strain San Juan) was amplified by polymerase chain reaction and inserted into the modified pEP98 vector, replacing gB. Single-point mutations were created using the Agilent QuikChange II Kit or NEB Q5 kit for site-directed mutagenesis.

Commercial E. coli strain BL21 (DE3) cells (Agilent) were transformed with a pETSAC plasmid containing the sequence for Aβ40 [54] (link), and bacteria were grown in minimal medium for ¹³C, ¹⁵N-labeled samples [37] (link) or LB media for unlabeled samples [54] (link). Cultures were grown and Aβ40 purified as described previously [37] (link), [49] . An identical procedure was used for purification of both labeled and unlabeled samples. The resulting Aβ40 protein contains an additional N-terminal methionine residue that has no effect on the fibrillation of Aβ40 or the morphology of fibrils formed [54] (link). Final protein concentrations were estimated from UV absorption in 7 M guanidinium chloride at 280 nm using an extinction coefficient of 1490 M^− 1 cm^− 1. Site-directed mutagenesis was performed using a Q5 kit (NEB) to create each variant of Aβ40. Substitutions were verified by plasmid sequencing (Beckman-Coulter Genomics). All variants were expressed and purified as described for the WT sequence.

pCMV6 vector encoding wild-type (WT) TLR7 was used as the parental vector for mutagenesis [6 ]. Mutant plasmids of TLR7 were generated via site-directed mutagenesis using the Q5 kit (E0554S; New England Biolabs) according to the manufacturer’s instructions and using oligonucleotides listed in the table below. NEB 5-alpha competent Escherichia coli were transformed with the ligated product, and colonies were screened by sequencing for the presence of the desired variants. pcDNA 3.1™ vector encoding V5-tagged human WT UNC93B1 has been described previously [5 ].

The gene of mS100A7 was synthetized by Genescript and subcloned in the pET11a plasmid using the NdeI and BamHI restriction sites. Deletion mutant mS100A7_1-100 (mS100A7ΔC) was generated using a Q5 kit from NEB by following the manufacturer instructions. The primers used were: 5′TAAGGATCCGGCTGCTAACAAAGC 3′; 5′GTGCGCGCACAGTTGACG 3′.