The assembly of synthetic operon in YEp352 was performed according to the BioBrick principles23 (link) described by Zelcbuch et al.24 (link) To further simplify the cloning process, a seamless, recombination-based cloning strategy was applied for the synthetic operon construction in YEplac181 using the ClonExpress II One Step Cloning Kit (Vazyme, Nanjing, China). The knockout of ROX1 and knockdown of ERG9 were achieved via CRISPR/Cas9 technologies.25 (link) For the CRISPR genome editing, yeast cells were pre-transformed with p414-TEF1p-Cas9-CYC1t plasmid (Addgene). All the PCR products were analyzed on 1% agarose gels and positive colonies were grown overnight for plasmid extraction using the Tianprep Rapid Mini Plasmid Kit (Tiangen, Beijing China) according to the manufacture's instructions. All clones were verified through the expression cassette sequencing (Sangon, China). The constructed plasmids containing the whole expression operon were chemically transformed into the yeast by S. cerevisiae EasyComp™ Transformation Kit (Invitrogen, CA, United States) and aliquots were plated on the corresponding auxotrophic minimal media. Table S4† lists the primers used to construct these plasmids and strains.
P414 tef1p cas9 cyc1t plasmid
Manufactured by Addgene
Sourced in United States
The P414-TEF1p-Cas9-CYC1t plasmid is a genetic construct designed for the expression of the Cas9 protein, a key component of the CRISPR-Cas9 gene editing system. This plasmid contains the TEF1 promoter to drive the expression of the Cas9 gene, and the CYC1 terminator to regulate the transcription. The core function of this plasmid is to provide a tool for the expression of Cas9 in various experimental systems.
Automatically generated - may contain errors
3 protocols using p414 tef1p cas9 cyc1t plasmid
1
Synthetic Operon Assembly and CRISPR Genome Editing
2
Cas9 and gRNA Expression Plasmid Construction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cas9 expression plasmid and gRNA expression plasmid were built on the basis of the constructs pGAP_HsCas9_DAS1 and pTEV1_StRNA2_AOX1TT respectively that were designed by Weninger [41 (link)]. For Cas9 expression plasmid, three fragments were assembled into pMA vector, including pGAP promoter which is amplified from pGAPZα vector (Invitrogen, San Diego, CA), encoding sequence of human (Homo sapiens) codon-optimized Cas9 (HsCas9) which is cloned from p414-TEF1p-Cas9-CYC1t plasmid (Addgene plasmid no. 43802, Cambridge, USA) and a synthesized fragment (GeneArt ThermoFisher, Buckinghamshire, UK) containing SV40 signal sequence, DAS1 terminator and PASR yeast replication origin in a sequential order.
The gRNA plasmid was constructed by assembling the synthesized fragment pTEV1_StRNA2_AOX1TT (GeneArt ThermoFisher, Buckinghamshire, UK) containing the target sequence “ACCAGATCCCGGTGTGGGAA
The gRNA plasmid was constructed by assembling the synthesized fragment pTEV1_StRNA2_AOX1TT (GeneArt ThermoFisher, Buckinghamshire, UK) containing the target sequence “
3
CRISPR-Cas9 Editing of Yeast Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mutants with inactivation of lncRNAs (transcr_20548 in BMA64-1A, transcr_10027 in BY4742, and transcr_3536 in SEY6210) and coding genes (CTA1 and IXR1 in BMA64-1A) were generated using CRISPR–Cas9. The genomic target regions were inserted into the pMEL16 plasmid (Addgene 107922) via PCR. Competent yeast cells were transformed with the modified pMEL16 plasmid, p414-TEF1p-Cas9-CYC1t plasmid (Addgene 43802), and the repair DNA. Recovered cells were placed on drop-out His- plus G418 medium, followed by incubation. Mutants were confirmed by colony PCR and sequencing. The population rebound after EtOH stress relief was assessed for mutants and wild-type strains, and spot tests were performed to assess the highest EtOH tolerance level of each mutant (Supplementary Table S19 ).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!