Cdna synthesis kit
The cDNA Synthesis Kit is a complete system for the reverse transcription of RNA into complementary DNA (cDNA). It includes all the necessary components for the efficient conversion of RNA into first-strand cDNA, which can then be used in various downstream applications such as PCR, qPCR, or cloning.
Lab products found in correlation
5 protocols using cdna synthesis kit
Quantitative Gene Expression Analysis
Quantitative mRNA Expression Analysis
Synchronized Worm RNA Extraction and qPCR Analysis
25 min using the EZB RNA kit (EZBioscience, USA) according to the manufacturer’s
directions. RNA was DNAse treated according to a protocol. RNA purity and integrity were
evaluated by the ratio of absorbance at 260 nm–280 nm (OD 260/280 ratio), and the ratio of
absorbance at 260 nm to 230 nm (OD 260/230 ratio) using a NanoDrop (ND-2000, Thermo
Science, USA). 1 μg of RNA was used to synthesize cDNA using an EZBioscience cDNA
synthesis kit. Real-time qPCR was performed by using the SYBR Green PCR Master Mix kit
(EZBioscience, USA) in an AP Biosystems RT-PCR machine. The thermocycling conditions were
as follows: Initial denaturation at 95°C for 5 min, 40 cycles of denaturation at 95°C for
15 sec, annealing at 55°C for 30 sec and extension at 70°C for 25 sec. Data from 3
biological repeats were analyzed using the comparative 2−ΔΔCt method. The
following primer sequences were used for qPCR: CDC-42 (ctgctggacaggaagattacg,
ctcggacattctcgaatgaag)
RNA Extraction and qRT-PCR Analysis of BMDMs
RNA Extraction and qRT-PCR Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!