Total cellular RNA was extracted using a TRIzol reagent (Invitrogen,), and 1 μg total RNA was reverse transcribed into first‐strand complementary DNA (cDNA) using a cDNA Synthesis Kit (EZBioscience) according to protocols. Afterwards, cDNA was used to measure the relative gene expression level using real‐time PCR. The expression of target genes was normalized to GAPDH levels in the samples in triplicate. The 2−ΔΔCT method was used to calculate the relative variation in gene expression. Additional file: Table S1 contains a list of primers.
Cdna synthesis kit
Manufactured by EZBioscience
Sourced in United States
The cDNA Synthesis Kit is a complete system for the reverse transcription of RNA into complementary DNA (cDNA). It includes all the necessary components for the efficient conversion of RNA into first-strand cDNA, which can then be used in various downstream applications such as PCR, qPCR, or cloning.
Automatically generated - may contain errors
Lab products found in correlation
Rna extraction column kit, by EZBioscience (2 mentions)
Sybr green master mix, by EZBioscience (2 mentions)
Lightcycler 480, by Roche (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Sybr green qpcr master mix, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr master mix kit, by EZBioscience (1 mentions)
Nanodrop nd 2000, by Thermo Fisher Scientific (1 mentions)
5 protocols using cdna synthesis kit
1
Quantitative Gene Expression Analysis
2
Quantitative mRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated with an RNA Purification Kit at room temperature according to the manufacturer’s instructions. For analysis of mRNA expression, 1 ug RNA was reverse-transcribed into cDNA with the cDNA synthesis kit (EZBioscience, United States). Quantitative real-time PCR analysis was then executed with SYBR green qPCR master mix on the Biorad PCR system (Thermo Fisher Scientific). GAPDH was taken as endogenous control. Each sample was run at least in triplicate. The primers used for qPCR analysis are listed in Supplementary Table 1 .
3
Synchronized Worm RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from some 800 synchronized worms with a 37°C heat stress for
25 min using the EZB RNA kit (EZBioscience, USA) according to the manufacturer’s
directions. RNA was DNAse treated according to a protocol. RNA purity and integrity were
evaluated by the ratio of absorbance at 260 nm–280 nm (OD 260/280 ratio), and the ratio of
absorbance at 260 nm to 230 nm (OD 260/230 ratio) using a NanoDrop (ND-2000, Thermo
Science, USA). 1 μg of RNA was used to synthesize cDNA using an EZBioscience cDNA
synthesis kit. Real-time qPCR was performed by using the SYBR Green PCR Master Mix kit
(EZBioscience, USA) in an AP Biosystems RT-PCR machine. The thermocycling conditions were
as follows: Initial denaturation at 95°C for 5 min, 40 cycles of denaturation at 95°C for
15 sec, annealing at 55°C for 30 sec and extension at 70°C for 25 sec. Data from 3
biological repeats were analyzed using the comparative 2−ΔΔCt method. The
following primer sequences were used for qPCR: CDC-42 (ctgctggacaggaagattacg,
ctcggacattctcgaatgaag)
25 min using the EZB RNA kit (EZBioscience, USA) according to the manufacturer’s
directions. RNA was DNAse treated according to a protocol. RNA purity and integrity were
evaluated by the ratio of absorbance at 260 nm–280 nm (OD 260/280 ratio), and the ratio of
absorbance at 260 nm to 230 nm (OD 260/230 ratio) using a NanoDrop (ND-2000, Thermo
Science, USA). 1 μg of RNA was used to synthesize cDNA using an EZBioscience cDNA
synthesis kit. Real-time qPCR was performed by using the SYBR Green PCR Master Mix kit
(EZBioscience, USA) in an AP Biosystems RT-PCR machine. The thermocycling conditions were
as follows: Initial denaturation at 95°C for 5 min, 40 cycles of denaturation at 95°C for
15 sec, annealing at 55°C for 30 sec and extension at 70°C for 25 sec. Data from 3
biological repeats were analyzed using the comparative 2−ΔΔCt method. The
following primer sequences were used for qPCR: CDC-42 (ctgctggacaggaagattacg,
ctcggacattctcgaatgaag)
4
RNA Extraction and qRT-PCR Analysis of BMDMs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After 24 h of incubation, total RNA was extracted from BMDMs in the four groups using an RNA extraction column kit (EZBioscience, USA) according to the manufacturer’s instructions. Subsequently, complementary DNA was synthesized from 1 μg of total RNA using a cDNA synthesis kit (EZBioscience, USA). Quantitative RT-PCR was performed using a SYBR Green Master mix (EZBioscience, USA) on LightCycler 480 (Roche, USA). The primers used are shown in Additional file 1 : Table S1.
5
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After 24 h of incubation, the total RNA was extracted using an RNA extraction column kit (EZBioscience, USA) according to the manufacturer's instructions. Subsequently, complementary DNA was synthesized from 1 μg of total RNA using a cDNA synthesis kit (EZBioscience, USA). Quantitative RT-PCR was performed using a SYBR Green Master mix (EZBioscience, USA) on LightCycler 480 (Roche, USA). The primers used are shown in Table S1.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!