Cell lysates were obtained from untransfected and pIRES-SRY HEK-293 transfected cells, harvested and washed with PBS and lysed in RIPA buffer. Lysates were incubated for 2 h on ice and centrifuged for 20 min at 10,000 rpm. Total protein was quantified by the Bradford method, and 15 μg were used in SDS-PAGE. Gels were transferred to PVDF membranes (Sigma-Aldrich), which were blocked and incubated with a monoclonal SRY antibody (H1; SC-374224 Santa Cruz Biotechnologies) at 1:1,000 dilution; a RNAPol II antibody (H-224; SC-9001, Santa Cruz Biotechnologies) at 1:500 dilution; a GAPDH antibody (Millipore) at 1:500 dilution, and secondary mouse or rabbit antibody (Sigma-Aldrich) at 1:15,000 dilution. Signals were revealed using a Infrared Imaging System (LI-COR Biosciences).
H 224 sc 9001
Manufactured by Santa Cruz Biotechnology
Sourced in Belgium
H-224 is a centrifuge capable of high-speed separation of biological samples. SC-9001 is a laboratory incubator used for controlled temperature cultivation of cell cultures. Both products are essential tools for life science research and development.
Automatically generated - may contain errors
Lab products found in correlation
3 protocols using h 224 sc 9001
1
Western Blot Analysis of SRY Expression
2
Progesterone Receptor Chromatin Immunoprecipitation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MDA-iPRA cells were cultured for 36–48 h in DMEM/charcoal-stripped fetal bovine serum followed by 1 h treatment with P4 (10 nM) and/or UPA (1 μM). ChIP assays were performed as previously described [28 ] (#HighCellChIP kit, Diagenode, Seraing, Belgium) with 5 μg of the appropriate ChIP grade antibodies: Human anti-PR (Anti-PR, sc-7208, Santa Cruz Biotechnology, CA); Rabbit anti-SRC1 antibody (M-341, sc-8995,Santa Cruz Biotechnology), rabbit anti-Polymerase II antibody (H-224, sc-9001, Santa Cruz Biotechnology) and control unrelated antibody from the #HighCellChIP kit (Diagenode).
3
RNAPII Occupancy Profiling via ChIP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNAPII ChIP experiments were performed using the ZymoSpin ChIP Kit (Zymo Research) according to instructions. A ChIP-grade anti-RNA-Polymerase II antibody (H-224, sc-9001, Santa Cruz Biotechnology) and as a control normal rabbit IgG (sc-2027, Santa Cruz Biotechnology) were used at concentrations of 2.5 µg/ChIP experiment. The sequences of the primer pairs for the detection of proRBM39 transcript occupancy were described before (Andersen et al. 2013 (link)) (proRBM39#1: fwd: GGGTGGAGAGGAAGTGGAAAAGTG, rev: CCCCTCTCCCCCTACCCCTAAAGA proRBM39#2: fwd: TGTGCCCCGAATTTAATCAGC, rev: TCAGGAAGGGGAACATTTTTGAA and proRBM39#4: fwd: AACAGCTAACTTCTGTTTCTGCT, rev: ACCTGAGAGGCAAAACCACT). Control primers detecting the RNA-Polymerase II occupancy of EGR1 were designed using the Primer3 online tool mentioned above: EGR1-1(fwd): CCGACACCAGCTCTCCAG, EGR1-2(rev): TCAGCAGCATCATCTCCTCC, EGR1-5(fwd): CAGTGGCCTAGTGAGCATGA, EGR1-6(rev): TTGTGGCTCAGGGAAAATGT. The combination EGR1-1/2 amplifies base pairs 239–394 and EGR1-5/6 the nucleotides 744–933 of human EGR1 (NM_001964.2).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!