Horseradish peroxidase hrp conjugated goat anti rabbit

Lenvatinib (HY-10981), gefitinib (HY-50895), and copanlisib (HY-15346A) were purchased from MedChemExpress (Shanghai, China), and elacridar (S7772) was purchased from Selleck Chemicals (Shanghai, China). Stock solutions of 20 mM Lenvatinib, 100 mM elacridar, and 20 mM gefitinib were dissolved in 100% dimethyl sulfoxide (DMSO), and the stock solution of 10 mM copanlisib was dissolved in Milli-Q water. Antibodies against total epidermal growth factor receptor (EGFR; A11577, ABclonal), phospho-EGFR (AP0820, ABclonal), total PI3K (ab32089, Abcam), phospho-PI3K (4228, CST), total AKT (9272, CST), phospho-AKT (4060, CST), total MEK1/2 (A4868, ABclonal), phospho-MEK1/2 (AP0209, ABclonal), total ERK1/2 (4695, CST), phospho-ERK1/2 (4376, CST), caspase-3 (T40051, Abmart), Bcl-2-associated X (Bax; T40044, Abmart), multidrug resistance protein 1 (MDR1; 13978, CST), breast cancer resistance protein (BCRP; 130244, Abcam), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH; 5174, CST) were used. Horseradish peroxidase (HRP)-conjugated goat anti-rabbit and goat anti-mouse antibodies were purchased from Beyotime Biotechnology (Shanghai, China). Alexa Fluor-conjugated goat anti-rabbit (647 nm) and goat anti-mouse (488 nm) antibodies were purchased from Invitrogen (Shanghai, China).

After screening for the potential biomarker gene, semen samples from teratozoospermia and normal controls were collected for further validation. Expression detection of the potential biomarker gene was performed by western blotting and qRT-PCR according to the previous protocol [44 (link), 45 (link)]. For western blotting, the primary antibodies used were: AGBL4 (1:500, Affinity Biosciences, OH, USA, Cat# DF3981) and GAPDH (1:2,000, Affinity Biosciences, Cincinnati, OH, USA, Cat# AF7021). And the secondary antibody used was: horseradish peroxidase (HRP)-conjugated goat anti-rabbit (1:1,000, Beyotime, Catalog no. A0208). Chemiluminescence was then performed using a BeyoECL Star Chemiluminescence Kit (Beyotime, Catalog no. P0018AS) and photographs were taken under enhanced chemiluminescence (ECL) detection system (ProteinSimple, San Jose, CA, USA). As for the qRT-PCR, total RNA from purified spermatozoa was extracted with TRIzol Reagent (Invitrogen) and the primer sequences were as follows: GAPDH, forward primer 5’ ACAACTTTGGTATCGTGGAAGG -3’, reverse primer 5’-GCCATCACGCCACAGTTTC-3’; AGBL4, forward primer 5’-ATGAGGAACGGTTCCAGAGGCA-3’, reverse primer 5’- GCAATAGGAAGTGTGGTCCAGG-3’.