The largest database of trusted experimental protocols

6 protocols using pcdna3 myc dnmt3a

1

Plasmid Construction and Validation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Kaiso-GFP, BTB-HA, pX459-Kaiso constructs were used the same as in [19 (link)]. Full-length Kaiso (1–692) was cloned in pGex-2T. pcDNA3/Myc-DNMT3B1 (Addgene plasmid # 35522), pcDNA3/Myc-DNMT3A (Addgene plasmid # 35521), pcDNA3/Myc-DNMT1 (Addgene plasmid # 36939) were a gifts from Arthur Riggs [42 (link),43 (link)]. For lentivirus purification, we used the pCDF system (System Bioscience): pVSV-G pFiv-34N plasmids. Kaiso was subcloned into pCDF1lentivirus-MCS2-EF1-Puro vector.
Plasmid for KLF4 editing was obtained as follows: ligation of BbsI-digested pSPCas9(BB)-2A-Puro (PX459) (Addgene # 48139) plasmid with annealed sgRNA oligo insert: Crisp_KLF4_for 5′-CACCGGAGCCGGTGCGGCTTGCGG, Crisp_KLF4_rev 5′-AAACCCGCAAGCCGCACCGGCTCC.All plasmids were verified by Sanger sequence analysis.
+ Open protocol
+ Expand
2

Engineered CRISPR Epigenetic Modifiers

Check if the same lab product or an alternative is used in the 5 most similar protocols
The dCas9 coding sequence was derived from pHR-SFFV-dCas9-BFP-KRAB (Addgene ID 46911) (a gift from Stanley Qi and Jonathan Weissman). The catalytic domains of DNMT1, DNMT3A, and DNMT3B were polymerase chain reaction (PCR)–amplified from pcDNA3/Myc-DNMT1 (Addgene ID 36939), pcDNA3/Myc-DNMT3A (Addgene ID 35521), and pcDNA3/Myc-DNMT3B1 (Addgene ID 35522) (a gift from Arthur Riggs), respectively. The DNMT3A (E752A) and DNMT3B (E697A) catalytically inactivating mutations were introduced by site-directed mutagenesis. All plasmids described in this study have been validated by Sanger sequencing and will be publically available through Addgene [17 ] (Supplementary Table S1).
+ Open protocol
+ Expand
3

Recombinant Expression of PHF6 and SUV4-20H2

Check if the same lab product or an alternative is used in the 5 most similar protocols
The PHF6 and SUV4-20H2 genes were amplified with specific primers using the cDNA of 293T as the template. The amplicons were ligated into pCMV-3× HA and pEGFP-C1, respectively, to generate recombinant expression constructs. pcDNA3/Myc-DNMT1 (Addgene plasmid # 36939) and pcDNA3/Myc-DNMT3A (Addgene plasmid # 35521) were kind gifts from Arthur Riggs.
The anti-DNMT3A (sc-20703), anti-RPA194 (sc-28714), anti-UBF (sc-9131 X), and anti-c Myc (sc-40 X) antibodies were purchased from Santa Cruz. The anti-α-tubulin (T6199), anti-HA (H9658), and anti-bromodeoxyuridine (BrdU) (B2531) antibodies were bought from Sigma. The anti-5-methylcytosine (BI-MECY-0100) antibody was purchased from Eurogentec, and the anti-PHF6 (Bethyl-451A) was purchased from Bethyl Laboratories. The anti-H4K20me3 (ab9053), anti-DNMT1 (ab13537), anti-GFP (ab290), and anti-H3 (ab1791) antibodies were bought from Abcam. The secondary antibodies, IRDye800CW goat anti-mouse IgG (926-32210) and IRDye800CW goat anti-rabbit IgG (926-32211) were purchased from LI-COR.
+ Open protocol
+ Expand
4

Overexpression of DNMT3A and HK2 in SKOV3 and 3AO Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human DNMT3A expression vector pcDNA3/Myc‐DNMT3A and HK2 expression vector PLHKII‐pGFPN3 were obtained from Addgene (Boston, MA, USA). SKOV3 and 3AO cells were seeded into 6‐well plates until 70%‐90% confluency and transiently transfected with vector pcDNA3/Myc‐DNMT3A(PLHKII‐pGFPN3) or empty vector using the X‐treme GENE HP DNA Transfection Reagent (Roche) following the manufacturer's protocol. After 48 hours of transfection, the cells were harvested for further study.
+ Open protocol
+ Expand
5

CRISPR-Mediated Epigenetic Editing of TP53

Check if the same lab product or an alternative is used in the 5 most similar protocols
pdCas9-DNMT3A-EGFP and pdCas9-DNMT3A-EGFP (ANV) was a gift from Vlatka Zoldoš (University of Zagreb, Zagreb, Croatia) (Addgene plasmids 71666 and 71685) (46 (link)). In this plasmid, the catalytic domain of human DNMT3A (amino acids P602-V912) was derived from the plasmid pcDNA3/Myc-DNMT3A (Addgene plasmid 35521) (106 (link)). An undesired BbsI restriction site was removed by site-directed mutagenesis without affecting the amino acid sequence. The DNMT3A active site motif ENV was mutated to ANV (E756A) (46 (link)). The sequences of the human TP53 guide RNAs used were a) CCGGTTCATGCCGCCCATGC; b) CGCTATCTGAGCAGCGCTCA; c) CCCCGGACGATATTGAACAA; d) GAGCGCTGCTCAGATAGCGA; and e) CCCACGGAACCCGCGGAGCC. pCAG-scFvGCN4sfGFPTET1CD and pCAG-dCas9-5xPlat2AflD were gifts from Izuho Hatada (Gunma University, Maebashi, Japan) (Addgene plasmids 82561 and 82560) (48 (link)). The sequence of the murine TP53 guide RNAs used were a) CGACCCTAGGCGCTTGGCTT b) ATCCTCCTCCGATTCCGAGC and c) TTCCTTCCCGCCTTCCCGCT. Guide RNAs were purchased from GenScript USA Inc. and Applied Biological Materials Inc.
+ Open protocol
+ Expand
6

DNMT Isoform Selectivity Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Compounds 1, 22 and 24 were tested to evaluate their selectivity on the different DNMT isoforms. To work selectively on DNMT1, DNMT3A, and DNMT3B, HEK293T cells were transfected with the plasmids containing the three different DNMTs' sequences and mock control. Cells were transfected with 2.5 μg of expression plasmid using Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA) according the manufacturer's instruction. Plasmids pcDNA3/Myc-DNMT1 (Addgene plasmid # 36939), pcDNA3/Myc-DNMT3A (Addgene plasmid # 35521), and pcDNA3/Myc-DNMT3B1 (Addgene plasmid # 35522) were a gift from Arthur Riggs. [39, 40] The presence of exogenous DNMTs was checked by Western blot (not shown), and afterward, the transfected cells were freshly lysed in RIPA buffer as above. Cellular extract of 35 μg were incubated with selected compounds at different concentration in the 1-150 μm range (1% DMSO final conc.) or with vehicle alone (1% DMSO) at 37 °C for 2 h. RG108 (Cayman) was used as positive controls, while as negative control, lysates were denatured at 100 °C for 30 min. DNMT activity was detected by DNMT activity/inhibitor assay kit (Epigentek). Data are presented as means ± SD; each compound was tested at least three times.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!