Quantitect reverse kit

Total RNA was extracted from mES cells using RNeasy kit (QIAGEN) and cDNA was made using Quantitect Reverse Kit (QIAGEN). The following primers were used in various combinations to obtain PCR fragments that cover the entire coding region of the mouse Piezo1 gene: TGCACTACTTCCACAGACCG, CAGGAAGATGAGCTTGGCGT, CTACTCCCTCTCACGTGTCCA, TCTACTGGCTGTTGCTGCC, CCAGCAACACAATGACCAGC, ATGGAGCCGCACGTGCTG, GATGCTGCCCCAGCCGTGGG, GGCCTGCCTCATCTGGACGG, AGCAGTTGGGCGACCTGGGC, TGCCCGCCCAGGCTGTGTGC, AGCCCAGCTCGTGCTGTGGG, CACGGTAGACGGGCTGACGC, CGGCGCTATGAGAACAAGCC, CGACCGTGCCCTCTACCTGC, GGAGTATACTAATGAGAAGC, AGG GACGCTGTGTCCCTACC, TACTGGATCTATGTGTGCGC, CATACCAGGTCACACAGGTC, TCCTCCTGATGCTCAAGCAGAGG, CTAGGTCCAGCAGCCGGTCAG, CTCACTCCATCATGTTCGAGG. PCRs were done using Phusion HF (NEB) or Pfu Ultra II (Agilent). For some difficult reactions 5% DMSO was added to the PCR reaction. The Piezo1 construct from N2A cells was obtained from the Patapoutian lab. For whole cell poking of both constructs transfected into HEK293 cells the following solutions were used (mM): 150KCl, 10Hepes, 10EGTA (pH 7.3 with NaOH, 310 mOsm/kg; intracellular) and 150NaCl, 3KCl, 2CaCl₂, 2MgCl₂, 10Hepes, 10Glucose (pH 7.3 with NaOH, 310 mOsm/kg; extracellular).