Total RNA was extracted from the MCPyV positive specimens in order to study the expression of transcripts from the MCPyV LT gene. Total RNA was extracted with the Quick-RNA Miniprep Plus Kit (Zymo Research) and treated with DNase to avoid the amplification of viral DNA. The RNA was reverse-transcribed in cDNA with ZymoScript RT PreMix Kit (Zymo Research) including all the necessary components needed to perform robust reverse transcription. After the RNA sample is added to ZymoScript RT PreMix, the reaction is incubated for 2 min at 25 °C to initiate the reverse-transcription step. After the reverse-transcription step, the extension phase occurred at 25 °C for 10 min. After inactivation of the RT enzyme at 95 °C for 1 min, an aliquot of the reverse transcription reaction mixture (1 μL) was used for the subsequent PCR amplification carried out with primer sequences to determine the LT gene expression (LT-RNA-F sequence (5′→3′): GATCAGGAGGATTCAGCTTCG, nucleotide position based on MCC350 genome: 910–930; LT-RNA-R sequence (5′→3′): CAGAGGATGAGGTGGGTTCC, nucleotide position based on MCC350 genome: 1133–1152; predicted product size: 242 bp) [39 (link)]. The β-globin gene was amplified to confirm the presence of PCR-amplifiable cDNA.
Quick rna miniprep plus kit
Manufactured by Zymo Research
Sourced in United States
The Quick-RNA Miniprep Plus Kit is a laboratory product designed for the rapid and efficient extraction of high-quality RNA from a variety of sample types. The kit utilizes a simple spin-column format to isolate total RNA, including small RNAs, from cells, tissues, and other biological samples.
Automatically generated - may contain errors
Lab products found in correlation
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (8 mentions)
Faststart sybr green master mix, by Roche (5 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (5 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (5 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (5 mentions)
Trizol, by Thermo Fisher Scientific (5 mentions)
Pet01 exontrap vector, by MoBiTec (4 mentions)
Primescript rt master mix, by Takara Bio (4 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (4 mentions)
Power sybr green rna to ct 1 step kit, by Thermo Fisher Scientific (4 mentions)
Dna rna shield, by Zymo Research (4 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (4 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (4 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (3 mentions)
Cfx96 touch real time pcr detection system, by Bio-Rad (3 mentions)
Iscript cdna synthesis kit, by Bio-Rad (3 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (3 mentions)
Revertra ace qpcr rt master mix, by Toyobo (3 mentions)
Nextseq 500 platform, by Illumina (3 mentions)
109 protocols using quick rna miniprep plus kit
1
Quantifying MCPyV LT Gene Expression
2
RNA Extraction and cDNA Synthesis for Viral Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted using the Quick-RNA Miniprep Plus Kit (Zymo Research, Irvine, CA, USA). After the RNA quality and quantity assessment by A230/A260 ratios, reverse transcription was performed by a ZymoScript RT PreMix Kit (Zymo Research, Irvine, CA, USA) and, following β-globin gene amplification to confirm cDNA’s quality, its product was used for PCR amplification in order to determine LT and VP1 gene expression [22 (link)].
3
RNA Extraction from SCAT Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The SCAT samples were transferred into screwcap tubes containing 1 mL of TRI Reagent (R2050-1 Zy-moResearch) and 2.3 mm of zirconia and silica beads (Biospec). The samples were placed on dry ice and homogenized 3 times at 3.4 m/s for 30 s using a bead mill tissue homogenizer (FisherScientific). Next, samples were centrifugated at 12,000 × g for 10 min at 4°C, and the liquid phase was collected carefully, avoiding the lipid layer on the top. Chloroform (200 µL) was added, and the samples were shaken for 15 s and placed on ice for 3 min. Following 15 min of centrifugation, the aqueous phase was collected and transferred to the Quick-RNA Miniprep plus kit (R1058 Zymo Research) to extract total RNA according to the manufacturer's protocol. DNase I (E1010 Zymo research) was used to eliminate genomic DNA. We stored RNA at -80°C, and the concentration and integrity of total RNA were evaluated using a NanoDrop 1000 spectrophotometer (Thermofisher Scientific). All samples had a 260:280 nm ratio between 1.91 and 2.01 and an RNA integrity number >6. Reverse transcription was performed with 200 ng of RNA using 4 µL of the qScript cDNA SuperMix (95048 Quantabio) for 5 min at 25°C, 30 min at 42°C, and 5 min at 85°C. The cDNA was stored at -20°C.
4
Nucleic Acid Isolation from Tissue Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using the Quick-RNA Miniprep Plus kit (Zymo Research) for fresh or frozen tissue specimens and the PinPoint Slide RNA Isolation System II kit (Zymo Research) for formalin-fixed, paraffin-embedded (FFPE)-preserved specimens. DNA was isolated from frozen tissue using the DNeasy Blood and Tissue Kit (Qiagen).
5
Quantitative Gene Expression Analysis via qPCR
6
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Quick RNA MiniPrep Plus kit (Zymo Research). The quantity and quality of the RNA were analyzed using NanoDrop. Total RNA was reverse transcribed using M-MuLV reverse transcriptase (New England Biolabs) following the manufacturer’s instruction. Quantitative real-time PCR was performed using 2× SYBR green master mix (Bimake). Relative gene expression was determined using ddCt method with Ribosomal protein L9 (rpl9) as reference. Sequences for primers are shown in the supplementary data (Supplementary file 1 ).
7
Quantification of Tumor Immune Markers
8
Mouse Ventricular RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All procedures for RNA extraction were performed in DNase/RNase-free conditions. For NRVMs, the media was rinsed away with ice-cold PBS and RNA extracted by TRIzol reagent, according to the manufacturer’s protocol. Ventricular tissue from 8-week mice was snap frozen and cryoground. Bulk RNA was extracted using the Zymo Quick-RNA Miniprep Plus Kit (R1057), following the manufacturer’s protocol with some modifications in the tissue digestion stage. All centrifugation steps were performed at 16,000 RCF and 4 °C. Then, 20 mg of cryoground tissue was mechanically homogenized on ice with disposable probes (Qiagen, TissueRuptor II) in 350 µl of DNA/RNA Shield. Next, 45 µl of proteinase K mix was added to 300 µl of sample, incubated for 30 min at 55 °C and centrifuged for 2 min after incubation. The supernatant was transferred to new microcentrifuge tubes, and 300 µl of RNA lysis buffer was added at 1:1 to the supernatant. Thereafter, the RNA purification procedure followed the manufacturer’s protocol with some differences: half-volume ethanol (300 µl) was added to isolate RNAs ≥200 nucleotides (nt) for poly(A) enrichment; DNase I treatment was performed in-column; and RNA was eluted in non-DEPC-treated nuclease-free water.
9
Quantitative Gene Expression Analysis via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For cells cultured in vitro, RNA isolation was performed with the Quick-RNA MiniPrep Plus Kit (Zymo). Reverse transcription was performed using the High Capacity RNA-to-cDNA Master Mix (Applied Biosystems), and qPCR was performed using PerfeCTa SYBR Green FastMix (Quanta) in a 7500 Real time PCR system (Applied Biosystems).
The xenograft tumours were snap-frozen with liquid nitrogen immediately after resection, and homogenized with Precellys Lysing kits (Bertin Instruments). Next, total RNA was extracted using standard TRIzol RNA extraction protocol. The cDNA was synthesized with SuperScript III First-Strand Synthesis System (Thermo Fisher), and qPCR was performed using PerfeCTa SYBR Green FastMix in a CFX Connect Real-Time PCR Detection System (BioRad).
Samples were amplified by 40 cycles of 10 seconds at 95°C and 30 seconds at 60°C. Results were calculated by the change-in-cycling-threshold (ΔΔCt) method as follows (relative to the reference control gene B2M and Gapdh, encoding β-2-microglobulin and glyceraldehyde phosphate dehydrogenase, respectively): −ΔΔCt = −(ΔCt Treatment − ΔCt Control), where ΔCt = Ct Target − ΔCt Ref.
The sequences of primers used can be found inSupplementary Table 6 .
The xenograft tumours were snap-frozen with liquid nitrogen immediately after resection, and homogenized with Precellys Lysing kits (Bertin Instruments). Next, total RNA was extracted using standard TRIzol RNA extraction protocol. The cDNA was synthesized with SuperScript III First-Strand Synthesis System (Thermo Fisher), and qPCR was performed using PerfeCTa SYBR Green FastMix in a CFX Connect Real-Time PCR Detection System (BioRad).
Samples were amplified by 40 cycles of 10 seconds at 95°C and 30 seconds at 60°C. Results were calculated by the change-in-cycling-threshold (ΔΔCt) method as follows (relative to the reference control gene B2M and Gapdh, encoding β-2-microglobulin and glyceraldehyde phosphate dehydrogenase, respectively): −ΔΔCt = −(ΔCt Treatment − ΔCt Control), where ΔCt = Ct Target − ΔCt Ref.
The sequences of primers used can be found in
10
RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Each of the obtained kidney, liver, and spleen samples were pooled and directly used for RNA extraction using the Quick-RNA MiniPrep Plus kit (Zymo Research) according to the manufacturer's instructions. The synthesis of the first strand cDNA was achieved by RT-PCR using the RevertAid Reverse Transcriptase kit (Thermo Scientific), the primer F1RTTiLV or F2RTTiLV5 (Figure 1 and Table 1), and treatments at 42 C for 60 min and 70 C for 10 min. The reaction products were stored at -20 C.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!