The PAA gel fragments were excised with a clean, sharp scalpel and incubated for 30 min at 50°C in 100 µL diffusion buffer (0.5M ammonium acetate, 10 mM magnesium acetate, 1 mM EDTA, 0.1% SDS). The supernatant was transferred to a new tube and DNA was isolated using the QIAGEN Gel extraction kit according to the manufacturer's protocol and eluted in 30 µL dH2O. The eluted PCR product was reamplified by PCR using the same primer pairs as in the initial PCR, analyzed on a 1% agarose gel, again excised with a clean, sharp scalpel and purified using the QIAGEN Gel extraction kit, eluted in 30 µL dH2O and sent to sequencing.
Gel extraction kit
Manufactured by Qiagen
Sourced in Germany, United States, United Kingdom, Japan, Netherlands, China, India
The Gel Extraction Kit is a laboratory tool designed to purify DNA fragments from agarose gels after electrophoresis. It facilitates the extraction and recovery of DNA samples from gel slices, ensuring high-quality DNA for subsequent applications such as cloning, sequencing, or PCR analysis.
Automatically generated - may contain errors
Lab products found in correlation
Qubit 2.0 fluorometer, by Thermo Fisher Scientific (231 mentions)
Phusion high fidelity pcr master mix, by New England Biolabs (170 mentions)
Truseq dna pcr free sample preparation kit, by Illumina (132 mentions)
Agilent bioanalyzer 2100 system, by Agilent Technologies (82 mentions)
Novaseq platform, by Illumina (64 mentions)
Hiseq 2500 platform, by Illumina (62 mentions)
Pgem t easy vector, by Promega (30 mentions)
Pcr purification kit, by Qiagen (24 mentions)
T4 dna ligase, by New England Biolabs (24 mentions)
Miseq platform, by Illumina (21 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (20 mentions)
Novaseq 6000 platform, by Illumina (16 mentions)
Novaseq 6000, by Illumina (15 mentions)
Miniprep kit, by Qiagen (14 mentions)
Bioanalyzer 2100 system, by Agilent Technologies (13 mentions)
Qiaamp dna stool mini kit, by Qiagen (13 mentions)
Dneasy blood and tissue kit, by Qiagen (13 mentions)
Restriction enzyme, by New England Biolabs (13 mentions)
Rneasy mini kit, by Qiagen (12 mentions)
Dnase 1, by Thermo Fisher Scientific (12 mentions)
1 089 protocols using gel extraction kit
1
Gel Extraction and Reamplification of DNA
2
Cry2 Plasmid Construction Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The tg(tetO:Cry2) vector was created from a full length Cry2 cDNA from ATTC (GenBank accession number BC054794) in the pYX-Asc vector. Due to the incompatibility of the pYX-Asc vector with the Gateway system, the Cry2 cDNA was first cloned from pYX-Asc into pTRE2pp to convert it to a Gateway compatible vector. pYX-Asc was linearized with AscI (New England BioLabs) and the ends were blunted with T4 DNA polymerase. The fragment was purified on a 1% agarose gel in 1X TBE and the 5.6 kb fragment was extracted using a Qiagen gel extraction kit (Cat. NO. 28706) by the methods described in the QIAquick Spin Handbook (Cat. NO. 28706). Simultaneously, digests were conducted on the pYX-Asc fragment with NotI (New England BioLabs) and the pTRE2pp vector with PvuII (blunt end, New England BioLabs) and NotI. Both of these fragments (a Cry2 3.9 kb and a pTRE2 3.8 kb fragment) were gel purified using the Qiagen gel extraction kit. The two purified fragments were then ligated with T4 DNA Ligase (New England BioLabs). The products of the ligation were transformed into DH5α cells and purified on LB + Amp 100 μg/mL plates. The presence of the correct fragments in the transformants and the purification of these fragments were conducted in the same manner as described above for tg(tetO:Cry1).
3
Generation of Transgenic Mice Expressing Mutant PrP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the generation of transgenic mice, sequences encoding WT PrP and mutant S1 and S3.F88W PrP were inserted into the MoPrP.Xho ‘half-genomic’ vector (Borchelt et al, 1996 (link); Fischer et al, 1996 (link)). Mutant PrP sequences were extracted from the mutant PrP plasmids described above using the primers 5′AAAAACTCGAGGCCCTCATCCCACGATCAGG3′ and 5′AAAAACTCGAGAGTCCAATTTAGGAGAGCCAAG3′, which contain XhoI restriction enzyme sites. Polymerase chain reaction (PCR) fragments were cloned into pCR2.1.TOPO (Invitrogen), and sequences were verified. DNA from TOPO clones was digested using XhoI (New England Biolabs), isolated by gel electrophoresis and purified with a gel extraction kit (Qiagen). The MoPrP.Xho vector was digested with XhoI, treated with calf intestinal alkaline phosphatase (New England Biolabs), phenol:chloroform-extracted and ethanol-precipitated or purified with the Ultraclean Gel Spin DNA Purification Kit (MoBio Laboratories). After ligation of digested fragments, the sequenced DNA was amplified and purified using the Endo-Free Maxiprep Kit (Qiagen). To prepare for injection, the DNA was digested with NotI and purified using the gel extraction kit (Qiagen) or Ultraclean Gel Spin DNA Purification Kit (MoBio Laboratories). The DNA was then injected into the pronuclei of mouse FVB embryos by the University of Calgary Transgenic Services.
4
Oligonucleotide Synthesis and Probe Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Using a microchip-based oligonucleotide synthesis, 11 510 oligonucleotides were synthesized, and this oligonucleotide pool contained 6.93 μg of single-stranded oligonucleotide in 80 μl (86.61 ng/μl) (CustomArray® Inc.). A total of 0.5 μl of oligonucleotide pool, 10 μl of KAPA HiFi polymerase (KAPA BIOSYSTEMS), 8 μl of dH2O with 1 μl of each forward and reverse primer (Supplementary Table S1) were used for probe amplification with the following PCR conditions: 95°C for 3 min; 15 cycles of 30 s at 95°C, 30 s at 60°C and 30 s at 72°C; and 10 min at 72°C. PCR-amplified samples were agarose-gel loaded and the correct bands were purified with a QIAGEN gel-extraction kit. We cleaved the flanking sequences with 1.5 μl of EarI (NEB® Inc) and 3.5 μl of NEB buffer (NEB® Inc) per 45 μl of probe template for 8 h at 37°C (Figure 1a ). The products were purified with a QIAGEN gel-extraction kit and stored at 4°C.
5
Cloning and Sequencing of 84 kDa MP Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The gene encoding the 84 KDa MP was amplified by Polymerase Chain Reaction (PCR), using Taq DNA polymerase (Promega) with oligonucleotides 5′ATACTGCAGGGCACGAGTCATGGCTTCAGCC 3′ (sense) and 5′ATATCTAGACCACTACCGCGTGGCACCAGTTGGGAGCTGGCAGCAGAGG 3′ (antisense) (the underlined regions are restriction sites of PstI and XbaI enzymes, respectively). This consisted of an initial denaturation step of 5 min at 95°C; 25 cycles of 45 s at 95°C, 45 s at 55°C, and 60 s at 72°C; and a final extension step for 7 min at 72°C. The amplified fragments were purified from agarose gels using Gel Extraction Kit (Qiagen).
To clone the MP84 gene, pPICZαB plasmid (Invitrogen) and purified amplified fragment were digested with PstI and XbaI restriction enzymes (New England Biolabs), and the ligation was performed with T4 DNA ligase enzyme (Promega). After transformation in Escherichia coli DH5α, some clones were selected to performance the Mini-prep using Gel Extraction Kit (Qiagen) and differential digestion assays were done to confirm the cloning. The positive clones were sequenced in an API-3100 (Applied Biosystems) automated sequencer and sequences were analyzed by DNASTAR Lasergene software (Version 7.2).
To clone the MP84 gene, pPICZαB plasmid (Invitrogen) and purified amplified fragment were digested with PstI and XbaI restriction enzymes (New England Biolabs), and the ligation was performed with T4 DNA ligase enzyme (Promega). After transformation in Escherichia coli DH5α, some clones were selected to performance the Mini-prep using Gel Extraction Kit (Qiagen) and differential digestion assays were done to confirm the cloning. The positive clones were sequenced in an API-3100 (Applied Biosystems) automated sequencer and sequences were analyzed by DNASTAR Lasergene software (Version 7.2).
6
Overexpressing MqsR, MqsA, and MqsRA in E. coli and P. putida
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To overexpress mqsR, mqsA, and mqsRA in E. coli and P. putida KT2440 hosts, the full coding region of mqsR, mqsA, and mqsRA were amplified with primer pairs listed in Supplementary Table S1 using P. putida KT2440 genomic DNA as the template. PCR products were purified using a gel extraction kit (Qiagen, Hilden, Germany), digested with EcoRI (or NheI for pHGE-base plasmids) and HindIII, and were purified with a PCR product purification kit (Qiagen). The purified PCR products were ligated into the pMQ70 and pHGE expression plasmids and transferred into E. coli WM3064 and P. putida KT2440, respectively. The correct constructs were verified by DNA sequencing using primer pairs pMQ70-f/r and pHGE-f/r.
For purification of the MqsA protein and MqsR/MqsA complex, the coding region of mqsA and mqsRA were amplified with primer pairs pET28b-mqsA-f/-r to make pET28b-mqsA-His, pET28b-mqsRA-f/pET28b-mqsRA-His-r to make pET28b-mqsRA-CHis (Supplementary TableS1 ) using P. putida KT2440 genomic DNA as the template, PCR products were purified using a gel extraction kit (Qiagen), and digested with NcoI and HindIII, and were purified with a PCR product purification kit (Qiagen). The purified PCR products were ligated into the pET28b plasmid and transferred into E. coli BL21. The correct constructs were verified by DNA sequencing using primer T7.
For purification of the MqsA protein and MqsR/MqsA complex, the coding region of mqsA and mqsRA were amplified with primer pairs pET28b-mqsA-f/-r to make pET28b-mqsA-His, pET28b-mqsRA-f/pET28b-mqsRA-His-r to make pET28b-mqsRA-CHis (Supplementary Table
7
In Vitro Transcription and Translation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
T7 PCR products were generated using a forward T7 primer, and a reverse primer located at the end of the SV40 polyA signal. The corresponding PCR product was gel purified using a gel extraction kit from Quiagen. In vitro transcription was performed using the T7 MEGAscript™ kit (life Technologies™). The RNA produced was then purified using a MEGAclear™ kit according to the manufacturer protocol (Life Technologies™). Rabbit reticulocyte lysate (RRL) based in vitro translation reactions were done using the Rabbit Reticulocyte Lysate System Nuclease Treated kit (Promega) according to the manufacturer’s instructions. Reactions were set up in a final volume of 25µl using 100ng of purified RNA, 1µl of RNAsin (Promega) and 17.5µl of RRL. The reaction was incubated 1h at 37°C and stopped by adding 100µl of PLB (Promega).
8
PCR Analysis of ABs, MVs, and EXOs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR analysis was performed with preamplified gDNA products from ABs, MVs, and EXOs from both PCa cell lines and plasma samples, using the specific designed primers (Table II and Supplementary Fig. S3). Each experiment was repeated a minimum of three times. The PCR reaction mixture contained 2 mM Mg2+, 100 mM dNTP mix, 10 µM of each primer, 5 U/µl of Paq 5000 DNA polymerase (Aguilent Technologies), 10 ng of gDNA and DEPC H2O up to 25 µl. PCR was performed in a T100 Thermal cycler (BioRad) and the thermal cycles were used as follows: 1 cycle of 2 min at 95°C, 34 cycles for 20 sec at 95°C, 20 sec at 60°C and 30 sec at 72°C, and 5 min at 72°C. The resulting PCR-products were validated by electrophoresis in 1% agarose gels. The bands were extracted and purified from the gel (Gel extraction kit and QIAqick PCR purification kit, Quiagen). Subsequently, a sequencing reaction was performed using BigDye Terminator (v.3.1) Cycle Sequencing Kit (Applied Biosystems), and run in an ABI 3730 DNA analyzer automated sequencer (Applied Biosystems).
9
In Vitro Transcription and Translation
10
Spag17 Gene Expression in Mouse Testes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from the mouse testes with TRIzol (Invitrogen, Carlsbad, CA, USA), total RNA was reversed transcribed with RETROscript kit (Ambion, Austin, TX, USA) according to the manufacturer’s instructions, and the cDNAs were used for PCR, using primer sets specific for mouse Spag17. Forward primer: 5′-CTTGAAGTGTCAACTTCTCC-3′ (located within exon 4); reverse primer: 5′-CCAAGCTCAGTCATAATGGCC-3′ (in exon 6). The amplification products were resolved on 1% agarose gel stained with ethidium bromide. The results presented are representative of three wild-type and knockout animals. DNA bands were cut, and DNA was extracted with Gel extraction kit (Quiagen, Hilden, Germany), following the manufacturer’s protocol. The amplified cDNA was submitted for sequencing to the VCU Nucleic Acids Research Facility.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!