Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA), and the reverse transcription was performed using uni all-in-One first-strand cDNA synthesis super-Mix for qPCR (Trans-Script, Beijing, China) according to the producer’s recommendations. Real-time PCR was performed in triplicate by SYBR Green fluorescent-based assay (638320, TaKaRa Bio Inc.) on a ViiATM7 RT-PCR system (Applied Biosystems, Carlsbad, CA). The primers for real-time PCR were listed as follows: MTFR2: Forward:5′-ATTTTGGCGTTCCTGTAGAACA-3′; Reverse: 5′-CAGAGTTCAAGAGCGGGATCA-3′; GAPDH: Forward:5′-CTGGGCTACACTGAGCACC-3′; Reverse:5′-AAGTGGTCGTTGAGGGCAATG-3′; Relative mRNA expression levels were calculated by the 2− (Δ Δ Ct) [Δ Ct = Ct (targeting gene)-Ct (GAPDH)] method and were normalized to the internal control of GAPDH.
Viiatm7 rt pcr system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The ViiATM7 RT-PCR system is a real-time PCR instrument designed for gene expression analysis, pathogen detection, and other molecular biology applications. The system utilizes a 96-well or 384-well format and supports a variety of fluorescent detection technologies. The ViiATM7 provides reliable and reproducible results for a wide range of sample types.
Automatically generated - may contain errors
Lab products found in correlation
Primescript kit, by Takara Bio (8 mentions)
Trizol reagent, by Thermo Fisher Scientific (7 mentions)
Sybr green fluorescent based assay, by Takara Bio (5 mentions)
Chamq universal sybr green master mix, by Vazyme (2 mentions)
Ficoll hypaque, by GE Healthcare (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Sybr qpcr master mix, by Takara Bio (1 mentions)
Sybr green fluorescence based assay, by Takara Bio (1 mentions)
9 protocols using viiatm7 rt pcr system
1
Quantitative Real-Time PCR for Gene Expression
2
Quantifying STAT6 Expression in BMMNCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bone marrow mononuclear cells (BMMNCs) were separated using Ficoll-Hypaque (GE Healthcare, United States). Total RNA was extracted from BMMNCs with Trizol reagent (Life Technologies, United States). Reverse transcription to cDNA was performed using PrimeScript Kit (TaKaRa, Japan). Real-time PCR using Cham Q Universal SYBR Green Master Mix (Vazyme, China) was completed on the ViiATM7 RT-PCR system (Applied Biosystems, USA). The primers used for STAT6 expression were: forward: 5ʹ-GTTCCGCCACTTGCCAATG-3ʹ, reverse: 5ʹ- TGGATCTCCCCTACTCGGTG-3ʹ. Relative STAT6 expression mRNA levels were calculated by 2−∆∆CT and were normalized to internal control (β-Actin).
3
Quantitative Analysis of EMT Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Trizol Reagent (Invitrogen) and the cDNA was synthetized using the PrimeScript™ Kit (TaKaRa Bio Inc., Otsu, Japan) following the manufacturer’s instructions. qRT-PCR was performed in triplicate using SYBR Green fluorescent-based assay (TaKaRa Bio Inc.) on a ViiATM7 RT-PCR system (Applied Biosystems, Carlsbad, CA). The primers for real-time PCR were listed as follows: E-cadherin Forward: 5′-TACGCCTGGGACTCCACCTA-3′, Reverse: 5′-CCAGAAACGGAGGCCTGAT-3′; Vimentin Forward: 5′-TGTGGATGT TTCCAAGCCTGAC-3′, Reverse: 5′-GAGTGGGTATCAACCAGAGGGAG-3′; N-cadherin Forward: 5′-CCACGCCGAGCCCCAGTATC-3′, Reverse: 5′-CCCCCA GTCGTTCAGGTAATCA-3′; Snail Forward: 5′-CACTATGCCGCGCTCTTTC-3′, Reverse: 5′-GCTGGAAGGTAAACTCl′GGATTAGA-3′; GAPDH Forward: 5′-CGG AGTCAACGGATTTGGTCGTAT-3′, Reverse: 5′-AGCCTTCTCCATGGTGGTGA AGAC-3′; Slug Forward: 5′-GGGCTCAGTTCGTAAAGG-3′, Reverse: 5′-GAGGAGGTGTCAGATGGA-3′; Twist Forward: 5′-TTTACATCCGATTTACTGC-3′, Reverse: 5′-CCTAATGCTTTCCCTCAT-3′; Zeb1 Forward: 5′-AAGTGGCGGTAGATGGTA-3′, Reverse: 5′-TTGTAGCGACTGGATTTT-3′. Relative mRNA expression levels were calculated by the 2−ΔCt [ΔCt = Ct (targeting gene)-Ct (GAPDH)] method and were normalized to the internal control of GAPDH.
4
Quantifying miRNA Expression Using qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol (Invitrogen, Waltham, MA, USA) and reverse transcribed using a PrimeScript kit (TaKaRa Bio, Otsu, Japan) according to the manufacturer’s instructions. qRT-PCR was performed with SYBR qPCR master mix (TaKaRa Bio) and a ViiATM7 RT-PCR system (Applied Biosystems, Carlsbad, CA, USA). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used to normalize the results. The miR-24 primers were designed and provided by Sangon Biotech (Shanghai, China), and miR-U6 was used as an internal control. The 2-ΔΔCt method was applied to analyze the expression of the target genes. The primer sequences are shown in Tables S1 .
5
Quantitative Analysis of EMT Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Trizol Reagent (Invitrogen, Waltham, MA), and cDNA was synthetized using a PrimeScript™ Kit (TaKaRa Bio Inc., Otsu, Japan) following the manufacturer’s instructions. qRT-PCR was performed in triplicate using a SYBR Green fluorescence-based assay (TaKaRa Bio Inc.) on a ViiATM7 RT-PCR system (Applied Biosystems, Carlsbad, CA). The primers used for real-time PCR were as follows: FOXC2 Forward: 5ʹ- CCTACCTGAGCGAGCAGAAT −3ʹ, Reverse: 5ʹ- ACCTTGACGAAGCACTCGTT −3ʹ; E-cadherin Forward: 5ʹ- TACGCCTGGGACTCCACCTA −3ʹ, Reverse: 5ʹ- CCAGAAACGGAGGCCTGAT −3ʹ; Vimentin Forward: 5ʹ- TGTGGATGT TTCCAAGCCTGAC −3ʹ, Reverse: 5ʹ- GAGTGGGTATCAACCAGAGGGAG −3ʹ; and GAPDH Forward: 5ʹ- CGGAGTCAACGGATTTGGTCGTAT −3ʹ, Reverse: 5ʹ- AGCCTTCTCCATGGTGGTGAAGAC −3ʹ. The relative mRNA expression values was normalized to GAPDH expression values and were calculated based on the Ct value according to the equation 2−ΔΔCt [ΔCt=Ct (targeting gene)-Ct (GAPDH)].
6
Quantifying Gene Expression by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The relative mRNA levels were assessed by quantitative reverse transcription PCR (qRT-PCR) [38 (link)]. After Trizol (Invitrogen, Carlsbad, CA) treatment, all RNAs of the liver tissues were obtained and the Prime Script Kit (TaKaRa Bio Inc., Japan) was performed for cDNA synthesis. qRT-PCR was performed on a ViiATM7 RT-PCR system (Applied Biosystems, Carlsbad, CA) using SYBR Green fluorescent-based assay (638320, TaKaRa Bio Inc. Japan). The β-actin gene was used as an internal standard and after normalizing to its expression level, the relative expression levels of α4nAChR, α7nAChR, and α-SMA were quantified by the 2−ΔΔCt method [39 (link)]. The reaction parameters were set as 50°C for 2 min, 95°C for 15 s, 95°C for 15 s, and 60°C for 1 min for 40 cycles. The primers of target genes were synthesized by Sinaclon (Tehran, Iran) and reported in Table 1 .
7
Quantitative RT-PCR Analysis of Oncogene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol Reagent (Invitrogen, Carlsbad, CA), and amplification of the cDNA (1 µg per sample) was performed using the Prime Script Kit (TaKaRa Bio Inc., Otsu, Japan) according to the manufacturer's indication. Real‐time PCR was performed in triplicate by SYBR Green fluorescent‐based assay (638320, TaKaRa Bio Inc.) on a ViiATM7 RT‐PCR system (Applied Biosystems, Carlsbad, CA). The primers for real‐time PCR were as follows: MLH1: forward: 5′‐CTCCAAGATGAGGCTGTAGGAA‐3′; reverse: 5′‐CCTATGAGATGGAAGGCAAGA‐3′; GAPDH forward: 5′‐CTGGGCACTGAGCACC‐3′; reverse: 5′‐AAGTGGTCGTTGAGGGCAATG‐3′; Her‐2 forward: 5′‐GATCCCCTGATAGACACCAACCGCTCTTCAAGAGAGAGCGGTTGGTGTCTATCATTTTTGGAAA‐3′; reverse: 5′‐AGCTTTTCCAAAAATGATAGACACCAACCGCTCTCTCTTGAAGAGCGGTTGGTGTCTATCAGGG‐3′; PI3K forward: 5′‐TGCTATGCCTGCTCTGTAGTGGT‐3′; reverse: 5′‐GTGTGACATTGAGGGAGTCGTTG‐3′; and AKT forward: 5′‐GTGCTGGAGGACAATGACTACGG‐3′; reverse: 5′‐AGCAGCCCTGAAAGCAAGGA‐3′. Relative mRNA expression levels were calculated by the 2−(ΔΔCt) method and were normalized to the internal control (GAPDH), ΔCt = Ct (targeting gene) − Ct (GAPDH), and ΔΔCt = ΔCt (treated) – ΔCt (control).
8
Quantification of BMP4, JNK1 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Trizol Reagent (15596018, Invitrogen, Carlsbad, CA) and the cDNA (1 μg per sample) was synthetized using the PrimeScript™ Kit (RR037A, TaKaRa Bio Inc., Otsu, Japan) according to the manufacturer’s protocols. qRT-PCR was performed in triplicate by SYBR Green fluorescent-based assay (638320, TaKaRa Bio Inc.) on a ViiATM7 RT-PCR system (Applied Biosystems, Carlsbad, CA). The primers for real-time PCR were listed as follows: BMP4 Forward: 5’-CTCCAAGAATGGAGGCTGTAGGAA-3′; Reverse: 5’-CCTATGAGATGGAGCAGGCAAGA-3′; GAPDH Forward: 5’-CTGGGCTACACTGAGCACC-3′; Reverse: 5’-AAGTGGTCGTTGAGGGCAATG-3′; JNK1 Forward: 5’-TCTGGTATGATCCTTCTGAAGCA-3′; Reverse: 5’-TCCTCCAAGTCCATAACTTCCTT-3′. Relative mRNA expression levels were calculated by the 2-ΔCt [ΔCt = Ct (targeting gene)-Ct (GAPDH)] method and were normalized to the internal control of GAPDH.
9
Real-Time PCR Analysis of CDK6 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bone marrow mononuclear cells (BMMNCs) were separated using Ficoll-Hypaque (GE Healthcare, United States). Total RNA was extracted from BMMNCs with Trizol reagent (Life Technologies, United States) and reverse transcription to complementary DNA (cDNA) was performed using PrimeScript Kit (TaKaRa, Japan) as described in our previous reports (Liang et al., 2017b (link)). Real-time PCR using ChamQ Universal SYBR Green Master Mix (Vazyme, China) was completed on the ViiATM7 RT-PCR system (Applied Biosystems, United States). The primers used for CDK6 expression were the following: forward, 5′–3′ CTGAATGCTCTTGCTCCTTT; reverse, 5′–3′ AAAGTTTTGGTGGTCCTTGA. Relative CDK6 expression mRNA levels were calculated by 2–ΔΔCT and were normalized to internal control (β-actin).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!