MicroRNA levels were assessed by quantitative PCR (qPCR) on a CFX384 detection system (Bio-Rad) with SYBR Green using the Exiqon PCR primer sets according to manufacturer’s instructions (Exiqon Inc.). Data was normalized to reference gene expression U6 snRNA and 5S rRNA. All primers for microRNAs and the reference genes were purchased from Exiqon Inc. Quantitative PCR for cytokines and reference genes GAPDH or β-actin was performed similarly using CFX384 detection system (Bio-Rad) and SYBR Green. Primers were as noted (Supplementary Table 1 ) and data normalized to reference gene expression.
Cfx384 detection system
Manufactured by Bio-Rad
Sourced in United States, Italy
The CFX384 detection system is a real-time PCR instrument designed for high-throughput nucleic acid detection and quantification. It features 384-well thermal cycler blocks and excitation and emission optical systems to enable simultaneous analysis of multiple samples.
Automatically generated - may contain errors
Lab products found in correlation
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (8 mentions)
Trizol reagent, by Thermo Fisher Scientific (7 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (4 mentions)
Tissuelyser, by Qiagen (3 mentions)
Illustra rnaspin mini kit, by GE Healthcare (3 mentions)
Kapa sybr fast qpcr master mix, by Roche (3 mentions)
M mulv reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Exiqon pcr primer sets, by Qiagen (2 mentions)
5 mm stainless steel bead, by Qiagen (2 mentions)
Nanodrop system, by Thermo Fisher Scientific (2 mentions)
Rneasy mini column, by Qiagen (2 mentions)
Quantitect reverse transcription kit, by Qiagen (2 mentions)
Nucleospin rna 2 kit, by Macherey-Nagel (2 mentions)
Revertaid h minus first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Sybr green master mix, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Mirneasy mini kit, by Qiagen (1 mentions)
Kapa sybr fast master mix, by Roche (1 mentions)
Lipofectamine ltx, by Thermo Fisher Scientific (1 mentions)
25 protocols using cfx384 detection system
1
Quantitative PCR Analysis of miRNA and Cytokines
2
Chemokine Receptor Expression Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA isolation was performed using the miRNeasy Mini Kit (Qiagen, Hilden, Germany), according to the manufacturer’s protocol. The isolated RNA was then transcribed into cDNA using the RevertAid H Minus First Strand cDNA Synthesis Kit (ThermoFisherScientific, Waltham, MA, USA), according to the manufacturer’s protocol.
Semi-quantitative real-time PCR (RQ-PCR) was performed in triplicates using the Bio-Rad CFX 384 detection system (Bio-Rad, Hercules, CA, USA). The nucleotide acid sequences for primers and probes used for RQ-PCR analysis of 18 chemokine receptors (CCR1-CCR9, CXCR1-CXCR7, CX3CR1, and XCR1) are shown inTable S1 (Supplementary Materials ). GAPDH and PPIA, possessing a high correlation coefficient (Spearman rho > 0.85 and p < 0.05), served as the housekeeping genes. All of the PCR assays were already tested, validated, and published in previous studies [17 (link),53 (link)]. The results are expressed as relative units based on calculation 2−ΔΔCT, giving the relative amount of the target gene normalized to the endogenous control (geometric mean of the GAPDH and PPIA) and relative to peripheral mononucleated cells [54 (link),55 (link)]. The undetermined values were set to a maximum of CT 45, in accordance with that of Goni et al. [55 (link)]
Semi-quantitative real-time PCR (RQ-PCR) was performed in triplicates using the Bio-Rad CFX 384 detection system (Bio-Rad, Hercules, CA, USA). The nucleotide acid sequences for primers and probes used for RQ-PCR analysis of 18 chemokine receptors (CCR1-CCR9, CXCR1-CXCR7, CX3CR1, and XCR1) are shown in
3
Quantification of gene expression in HEK 293T cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK 293T cells were obtained from ATCC (American Type Culture Collection, LGC Standards, Molsheim, France) and were cultured in DMEM supplemented with antibiotics, L-glutamine and 10% FBS serum. Cells were seeded in 6-well plates and transfected with MIG-empty or MIC-MYC expression vectors using Lipofectamine LTX (Invitrogen, Life Technologies, Milan, Italy). After 24 hours cells were harvested and total RNA was extracted as described above. cDNA was generated from 2mg of RNA using the RevertAid First Strand cDNA Synthesis kit following manufacturer's recommendations (Thermo Fisher Scientific, Milan, Italy). Twenty-five ng of cDNA were used for RT-qPCR experiments to detect expression levels for c-MYC, ADAM19, MAP2K1, TRAF4 and FAS mRNAs. Primers were designed using Primer-Blast tool and tested for efficiency and specificity. YWHAZ and ACTB were used as reference genes. mRNA expression was measured through Kapa Sybr Fast Master Mix (Kapa Biosystems, Resnova, Ancona, Italy) and the CFX384 Detection System (BioRad, Milan, Italy). Expression values were obtained as ΔΔCt calculations normalized on reference genes as previously described [77 (link), 78 (link)].
A list of the primer sequences used both for RT-PCR and RT-qPCR reactions is presented inSupplementary Table 5 .
A list of the primer sequences used both for RT-PCR and RT-qPCR reactions is presented in
4
Quantitative RT-PCR Protocol for Cultured Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole-cell RNA from cultured cells was extracted using NucleoSpin-RNA II kit RNA (Machery Nagel) according to protocol. Subsequently, 1 µg RNA was reverse-transcribed using random hexamers (Fermentas) and M-MuLV reverse transcriptase (Life Technologies). 20 ng of cDNA was amplified in a CFX384 detection system (Biorad) using the TaqMan precision PLUS Master mix (Primerdesign). The gene expression level was normalised to three housekeeping genes (eEF1a1, HPRT, GAPDH) using qBase software [31] (link). Each CT value used for these calculations is the mean of duplicates of the same reaction. Relative RNA levels are expressed as percentages of the average control groups. Taqman primers were obtained from Primerdesign and Life Technologies.
5
Optimized Multiplex PCR Primers for SARS-CoV-2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Optimized multiplex PCR primers for SARS-CoV-2 (N, S, E and RdRP) and human genes (PPIB and ACTB/G) were designed using the SPAR-Seq pipeline8 (link), with amplicon size >100 bases (see Supplementary Table 1 and Supplementary Data 1 ). For the S gene, two regions were monitored, the S receptor-binding domain (Srbd), and S polybasic cleavage site (Spbs). The Universal adapter sequences used for sequencing were F: 5′-acactctttccctacacgacgctcttccgatct and R: 5′-gtgactggagttcagacgtgtgctcttccgatct). Primers were optimized to avoid primer–dimer and non-specific multiplex amplification. To assess the primers sensitivity and specificity, we performed qPCR (SYBR green master mix, BioApplied) on cDNA prepared from patient samples. Each primer was used at 0.1 μM in qPCR reaction run on 384-well plates using Biorad CFX 384 detection system. The thermal cycling conditions were as follows: one cycle at 95 °C for 2 min, and then 40 cycles of 95 °C for 15 arcsec, 60 °C for 15 arcsec, 72 °C for 20 arcsec, followed by a final melting curve step.
6
Quantification of alg-1 Expression in C. elegans
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from 300 day-1 adult worms was extracted using TRIzol Reagent (Thermo Fisher Scientific, 15596018). Reverse transcription was performed using 200 ng of total RNA and High-Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific, 4368814) according to the manufacturer’s protocol. Real-time PCR was conducted using SYBR Green Master Mix (Thermo Fisher Scientific, 4309155) and primers at the final concentration of 0.5 μM. Fluorescence was detected using the CFX384 Detection System (Bio-Rad Laboratories). Real-Time PCR System following the protocol: 95 °C−5 min and 40 cycles of 95 °C−15 s, 60 °C−20 s, and 72 °C−30 s. Expression levels were normalized using the reference gene Y45F10D.4. Primers used: alg-1 forward - CGCGCTCGTTAATCATCTTGT, alg-1 reverse - GGATGAACCTGCACAGCTC, Y45F10.4 forward - CGAGAACCCGCGAAATGTCGGA, Y45F10.4 reverse - CGGTTGCCAGGGAAGATGAGGC.
7
Comprehensive miRNA and mRNA expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from cell lysates using the Quick-RNA MiniPrep kit with on-column DNase I treatment (Zymo Research, USA) according to the manufacturer’s protocol. RNA purity and quality were assessed using the NanoDrop2000 Spectrophotometer (Thermo Scientific, USA). 500ng of RNA were used to perform reverse transcription using the miScript RT II Kit and HiFlex Buffer Reverse Transcription (Qiagen, Netherlands). Quantitative polymerase chain reaction (qPCR) was performed in technical triplicates using the CFX384 Detection System (BioRad, USA) using 5ng and 50ng of cDNA as a template for subsequent miRNA and mRNA expression detection, respectively. Primers were purchased from Qiagen (miScript Primer Assay range) and from Eurogentec (primer list Supplementary Table 4 ) to respectively amplify miRNA and mRNA. Amplification curves were analyzed using CFX software (BioRad, USA) and expression was normalised using three housekeeping genes (RNU1A, RNU5A, SCARNA17 for miRNA and HPRT, PPIA, TBP for mRNA). Statistical significance was calculated for each condition considering biological replicates (n = 3) using multiple welch’s t-test and an FDR of 0.01.
8
Quantifying Tick-Borne Pathogen Infection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Peripheral blood smears were fixed and stained with FisherBrand Hema 3 solutions (ThermoFisher, Waltham, MA, USA) and examined by light microscopy for the presence of neutrophils with morulae. Three blood smears were examined per time point per mouse in order for the percentage of infected neutrophils to be determined from a total of at least 300 neutrophils. DNA was isolated from heparin-treated blood using the DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA, USA). Fifty nanograms of DNA were subjected to quantitative PCR (qPCR) using primers targeting A. phagocytophilum 16S rDNA and mouse β-actin [29 (link)], SsoFast EvaGreen Supermix (Biorad, Hercules, CA, USA), and the CFX384 Detection System (Biorad). Thermal cycling conditions consisted of an initial denaturation step of 98 °C for 2 min and was followed by 40 cycles at 98 °C for 5 s and 60 °C for 30 s. The relative 16 S rDNA levels were normalized to that of β-actin using the 2−ΔΔCT method [30 (link)]. To assess for splenomegaly, spleen-to-body weight ratios were determined on day 28.
9
RNA Extraction and Real-time qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol Reagent (Invitrogen) was used to extract total RNA from cells or mouse tissues, and total RNA (2 µg) was subjected to reverse transcription into cDNA using the PrimeScript RT-PCR kit (Takara, Seoul, Korea). Real-time PCR was performed using SYBR Premix Ex Taq II (Takara) with a CFX384 detection system (Bio-Rad Laboratories, Hercules, CA, USA). Primer sequences are given in Supplementary Table S2
10
Quantitative PCR Protocols for Mice and Zebrafish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For mice, RNA was extracted using Qiagen RNeasy minikit (Qiagen) and reverse-transcribed into cDNA with High-Capacity cDNA reverse transcription kit (Applied Biosystems). qPCR was performed using Power SYBR Green PCR kit (Applied Biosystems) and run on a 7900HT Fast Real-Time PCR system (Applied Biosystems). Human and mouse qPCR primers are listed in Supplemental Tables S6 and S7.
For zebrafish, RNA was extracted using RNAqueous microkit (Life Technologies). cDNA was synthetized and amplified using Ovation Pico WTA system version 2 (Nugen) prior to qPCR. qPCR was performed on cDNA isolated from pooled embryos using the Bio-Rad CFX384 detection system. Zebrafish primer sequences are listed in Supplemental Table S8.
For zebrafish, RNA was extracted using RNAqueous microkit (Life Technologies). cDNA was synthetized and amplified using Ovation Pico WTA system version 2 (Nugen) prior to qPCR. qPCR was performed on cDNA isolated from pooled embryos using the Bio-Rad CFX384 detection system. Zebrafish primer sequences are listed in Supplemental Table S8.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!