Px330

To construct CRISPR/Cas plasmids for HBB targeting, sgRNA oligos were synthesized by IDT and cloned into pX330 (Addgene: plasmid #42230) and pX335 (Addgene: plasmid #42335), respectively, following the Zhang lab protocol (https://www.addgene.org/crispr/zhang/).
To construct CRISPR/Cas double nicking plasmids for HBB targeting, human 7SK promoter-driven truncated sgRNA sequences49 (link) were synthesized by IDT and cloned into the KpnI site of one sgRNA-bearing pX335 vector by Gibson Assembly (NEB).
The CRISPR/Cas components of pX330-HBB-T2 were transferred to the shuttle vector pM7.7 via PciI and NotI sites to derive pM7.7-330- HBB-T2.

KO was performed as recently described¹⁸, ²⁵, ³³ using pX330 and pCAG‐EGxxFP³⁴ purchased from Addgene. In CRISPR/Cas9‐based gene disruption, guide (g) RNA sequences (5’‐AGCTGTGGCAGCGTCAACAG‐3′) corresponding to the MET gene (394–413 bp from the initiation ATG site), (5’‐GAGGGCGAACGACGCTCTGC‐3′) HER3 gene (3–22 bp from the initiation ATG site), and FOXM1(5’‐CCGTCGGCCACTGATTCTCA‐3′) gene (15–33 bp from the initiation ATG site) were designed using CRISPR direct (https://crispr.dbcls.jp/). SW1116 cells were used to generate HER3 and/or MET and the FOXM1‐KO cell line using the pX330 (Addgene) and pCAG‐EG × ×FP (Addgene) CRISPR/Cas9 vectors. The gene‐specific region of gRNA sequences was designed by the CRISPR design tool from CRISPR direct (https:/crispr.dbcls.jp/). Single clones were picked up and the KO efficiency was assessed by WB and FCM. Cells were seeded onto 35‐mm dishes (BD BioCoat, Franklin Lakes, NJ, USA) in 1 mL of RD medium, and plasmid DNA (5 μg) was introduced into cells of approximately 80% confluency using Xfect transfection reagent (Takara Bio Inc.). The co‐transfection of pX330 and pUC19 (#3219, Takara Bio) containing the puromycin‐resistant gene was also performed, and cells were cultured with puromycin (Invitrogen, 2 μg/mL) for 10 days.

Targeting sequences of sgRNA in the CRISPR/Cas9 system were determined using CRISPRdirect (https://crispr.dbcls.jp/). The targeting sgRNA sequence used in this study was 5′-GGGACCAGGTTTAATGTCCG-3′. According to the Zhang Lab General cloning protocol (http://www.addgene.org/crispr/zhang/), synthesized and annealed sgRNA targeting human SYNJ1 was inserted into the modified pX330 plasmid (pX330; Addgene #42230) in which a P2A-puromycin resistance gene was conjugated to Cas9 (hereafter referred to as pCas9-puroR).

As illustrated in Figure 1A-a, the pCas9gG-Rosa26 vector was constructed on the base of our homemade vector pU6CGR, which contains U6 promoter to drive small guide RNA (sgRNAs) expression. First, the CAG-spCas9 expression cassette was PCR amplified from pX330 (Addgene plasmid #42230), resulting in pCas9(CAG-spCas9-U6-EF1-eGFP-PA). Gibson Assembly reaction [75 (link)] was carried out to knockout the BmsI site in spCas9 cDNA sequence. To express dual sgRNAs that target the Rosa26 locus, we subcloned the fragments containing U6 promoter and sgRNA scaffold into the above vector. Two previously characterized Rosa26-targeting sgRNAs [49 (link)] were chosen and subcloned into the BsmI and BbsI sites, respectively: sgRNA1, GCG CAC TAG ACG TTG AGG TCagg and sgRNA2, GAA GAT GGG CGG GAG TCT TCtgg, where the PAM sequences are in lower case. Lastly, a CMV-driven eGFP expression cassette was subcloned into the vector for monitoring transfection efficiency. The final construct was designated as pCas9gG-Rosa26, which is used to deliver constitutive expression of spCas9 and a pair of gRNAs to produce dual gRNA-guided double-nicking in mouse Rosa26 locus. All cloning junctions and critical sequences were sequencing verified. Details about the vector construction are available upon request.

HEK293 and CCD-841-CoN SALL2 total knockout clones were obtained by CRISPR-Cas9, as described in Escobar et al. (2015) (link) and Hermosilla et al. (2018) (link). The HEK293 SALL2 E1A-knockout cell model was obtained by electroporation at 1100 volts per 20 milliseconds (NEON Transfection System, Thermo Fisher Scientific), with a vector encoding Cas9, a specific SALL2 RNA guide (pX330, Addgene), and GFP or RFP-containing vector used as a transfection marker. Control cells were electroporated using the GFP or RFP-containing vector alone. Supplementary Table 1 indicates the specific human SALL2 guide RNAs and primers used for PCR reactions and sequencing. We collected 1000 cells by GFP sorting from which ten clones were obtained. From three clones, genomic DNA was purified and sequenced, giving one clone with the expected deletion (clone 17). Validation of SALL2 E1A included Sanger sequencing (performed at Pontificia Universidad Católica Sequencing Facility, Santiago, Chile) and Western Blot analysis (Supplementary Figures 2, 3).