Eca109 (Procell Life Science & Technology Co., Ltd) and Kyse150 (Cell Bank, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai) cells were chosen as the representative cell lines of Human ESCC. The cells were cultured in RPMI 1640 medium (Gibco; Thermo Fisher Scientific, Inc., USA) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc., USA) and 1% penicillin-streptomycin antibiotic solution. All cultures were maintained in a humidified incubator with 5% CO2 atmosphere at 37°C. ESCC cells were treated with Baicalein (Selleck, China) or DMSO (Solarbio, China) for 24 hrs with or without pretreated with 100 nM 12(S)-HETE (Cayman Chemical, USA) 4 hrs prior to the inhibitor. Or they were transfected with 12-LOX-specific siRNA (si12-LOX, Stealth RNAi siRNA Card for human Alox12, Catalog #1299003; three 12-LOX-specific 20–25 nt siRNA construct, Invitrogen, USA) and non-targeting siRNA (siNC) using EndoFectinTM–MAX (GeneCopoeia, China) with or without treated with 100 nM 12(S)-HETE/5 ng/mL TGF-β1 (Peprotech, USA) for an additional 24 hrs.
Eca 109
Manufactured by Procell
Sourced in China
The Eca-109 is a laboratory instrument used for electrochemical analysis. It measures and records the electrical properties of chemical reactions. The core function of the Eca-109 is to perform electrochemical experiments and provide data on the behavior of chemical systems.
Automatically generated - may contain errors
Lab products found in correlation
Kyse150, by Procell (5 mentions)
Kyse30, by Procell (3 mentions)
Het 1a, by American Type Culture Collection (2 mentions)
Baicalein, by Selleck Chemicals (1 mentions)
12 s hete, by Cayman Chemical (1 mentions)
Endofectintm max, by GeneCopoeia (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Tgf β1, by Thermo Fisher Scientific (1 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (1 mentions)
Dimethyl sulfoxide (dmso), by Solarbio (1 mentions)
Kyse 150, by Thermo Fisher Scientific (1 mentions)
1640 medium, by Thermo Fisher Scientific (1 mentions)
Ec9706, by Thermo Fisher Scientific (1 mentions)
Kyse30, by Thermo Fisher Scientific (1 mentions)
Kyse170, by Procell (1 mentions)
Kyse170, by Thermo Fisher Scientific (1 mentions)
Eca 109, by Thermo Fisher Scientific (1 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions)
Dmem medium, by Thermo Fisher Scientific (1 mentions)
Penicillin streptomycin, by Solarbio (1 mentions)
9 protocols using eca 109
1
Esophageal Squamous Cell Carcinoma Cell Line Assays
2
Culturing Esophageal Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The esophageal cancer cell lines Eca109, TE1, KYSE30, YES2, EC9706, KYSE170 and KYSE150 were obtained from Procell Life Science&Technology Co. (Wuhan, China). Eca109, YES2, EC9706, KYSE170 and KYSE150 were cultured in DMEM medium (GIBCO, USA) containing 10% fetal bovine serum (FBS; Biological Industries, Beit-Haemek, Israel) and 1% penicillin-streptomycin (Solarbio, China) with 5% CO2 at 37 °C in a humidified incubator. TE1 and KYSE30 cells were cultured in 1640 medium (GIBCO, USA) containing 10% FBS and 1% penicillin-streptomycin with 5% CO2 at 37 °C in a humidified incubator.
3
RT-qPCR and Protein Analysis of ZPR1 in ESCC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human ESCC cell lines KYSE150, Eca109, TE1, and the normal esophageal cell line HEEC, obtained from Procell Life Science & Technology Co., Ltd, were maintained in a 5% CO2 incubator at 37°C in T25 culture flasks.
The total RNA was extracted using TRIzol (LEAGENE) from cell lines in the logarithmic growth phase and in good growth condition, and was inverted into cDNA using the RevertAid First Strand cDNA Synthesis Kits (Novoprotein). Gene‐specific primers used for RT‐qPCR were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The primers for ZPR1 were 5′‐CGC CTCCT GCTC ACCA AGATTC‐3′ (forward) and 5′‐CCGACTGGATCTC CGTGTTGTTC‐3′ (reverse), and for GAPDH were 5′‐CGGAGTCAACGGATTTGGTCGTAT‐3′ (forward) and 5′‐AGCCT TCTCCATG GTGGTGAAGAC‐3′ (reverse). The total proteins were extracted using RIPA lysis buffer and PMSF protease inhibitor (Solarbio), and the bicinchoninic acid (Dingguo) method was used to determine the concentration of total proteins, and then equal amounts of protein were loaded and separated using SDS‐PAGE.
The total RNA was extracted using TRIzol (LEAGENE) from cell lines in the logarithmic growth phase and in good growth condition, and was inverted into cDNA using the RevertAid First Strand cDNA Synthesis Kits (Novoprotein). Gene‐specific primers used for RT‐qPCR were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The primers for ZPR1 were 5′‐CGC CTCCT GCTC ACCA AGATTC‐3′ (forward) and 5′‐CCGACTGGATCTC CGTGTTGTTC‐3′ (reverse), and for GAPDH were 5′‐CGGAGTCAACGGATTTGGTCGTAT‐3′ (forward) and 5′‐AGCCT TCTCCATG GTGGTGAAGAC‐3′ (reverse). The total proteins were extracted using RIPA lysis buffer and PMSF protease inhibitor (Solarbio), and the bicinchoninic acid (Dingguo) method was used to determine the concentration of total proteins, and then equal amounts of protein were loaded and separated using SDS‐PAGE.
4
Apigenin Inhibits Esophageal Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human esophagus cancer Eca-109 and Kyse-30 cell lines were purchased from Procell Life Science & Technology Co., Ltd., and Cellcook Biotechnology Co., Ltd. Cells were cultured at 37°C in a humidified atmosphere of 5% CO2 in the RPMI1640 medium, supplemented with 10% fetal bovine serum and antibiotics (100 U/ml penicillin and 100 mg/ml streptomycin). Apigenin was obtained from Sigma-Aldrich and dissolved in dimethyl sulfoxide, stored at −20°C until ready for use. Growth factor–reduced Matrigel was from BD Biosciences (Bedford, MA, USA). The pIL-6-promoter-luc and Renilla-luc plasmids were purchased from Beyotime Biotechnology (Shanghai, China). The antibodies against PARP and caspase-8 were from Cell Signaling Technology (Beverly, MA, USA). Monoclonal antibodies against IL-6 and GAPDH were from Proteintech (Wuhan, China).
5
FAM83D Regulates ESCC Radiosensitivity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human normal esophageal cell line HEEC was purchased from the Cellular Biology Institute of the Shanghai Academy of Sciences (Shanghai, China). The human ESCC cell lines ECA109 and TE1 were purchased from Procell Life Science & Technology Co., Ltd. (Wuhan, China). EC9706, KYSE30 and KYSE180 cell lines were purchased from Otwo Biotech Inc. (Shenzhen, China). The above cell lines were cultured in RPMI 1640 supplemented with 10% fetal bovine serum (FBS) at 37°C in 5% CO2. Plasmid containing the short hairpin RNA (shRNA) of FAM83D and the negative control (shNC) shRNA were purchased from GeneChem. Cells were seeded in 6-well plates and incubated for 24 h and transfected using Lipofectamine RNAiMAX (Invitrogen, USA) according to the manufacturer’s protocol. To obtain cells stably expressing FAM83D shRNA, G418 was added twenty-four hours after transfection, and stable transfectants were obtained after several weeks. Cells were irradiated at room temperature with a 6-MV Siemens linear accelerator (Siemens, Concord, CA) at a dose rate of 5 Gy/min after stable transfection and allowed to recover in an incubator for the indicated time until harvesting.
6
Culturing Esophageal Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
7
Culturing Esophageal Cancer and Normal Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human EC cell lines (Eca-109 and KYSE-150), obtained from Procell (Wuhan, China), were maintained in DMEM (Gibco-BRL, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS; HyClone, Chicago, IL, USA). Human normal esophageal mucosal epithelial cell line Het-1A, obtained from ATCC (Manassas, VA, USA), was maintained in BEGM medium kit (Lonza/Clonetics Corporation, Walkersville, MD, USA). All cells were cultured in a 5% CO2 atmosphere at 37 °C.
8
Establishment and Maintenance of Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Normal esophageal epithelial cells (HET-1A) were acquired from ATCC (Manassas, VA, USA). TE-1, Eca-109, KYSE150, and HUVEC cell lines were obtained from Procell (Wuhan, China), while KYSE70 cells were provided by TongPai Biotechnology (Shanghai, China). KYSE70 cells and KYSE150 cells were maintained in RPMI-1640 medium, and other cells were cultivated in a DMEM medium. During cell culture, medium was supplemented with 1% penicillin/streptomycin (Procell) and 10% fetal bovine serum (FBS). The culture conditions were 37 °C, 5% CO2, and 95% humidity.
SiRNAs for circCHSY1 (si-circCHSY1-1 and si-circCHSY1-2), shRNA against circCHSY1 (sh-circCHSY1), miR-1229-3p mimic and inhibitor, Tectonic-1 (TCTN1) overexpressed plasmid (pcDNA-TCTN1) and their negative controls were all provided by GenePharma (Shanghai, China). When the cell aggregation rate reached 80%, 50 nM of miRNA mimic, different substances (20 pmoL of siRNA, 0.8 µg of plasmids, and 100 nM of miRNA inhibitor) were used for cell transfection by Lipofectamine™ 3000 (Invitrogen, Carlsbad, CA, USA) depending on the experimental requirements.
SiRNAs for circCHSY1 (si-circCHSY1-1 and si-circCHSY1-2), shRNA against circCHSY1 (sh-circCHSY1), miR-1229-3p mimic and inhibitor, Tectonic-1 (TCTN1) overexpressed plasmid (pcDNA-TCTN1) and their negative controls were all provided by GenePharma (Shanghai, China). When the cell aggregation rate reached 80%, 50 nM of miRNA mimic, different substances (20 pmoL of siRNA, 0.8 µg of plasmids, and 100 nM of miRNA inhibitor) were used for cell transfection by Lipofectamine™ 3000 (Invitrogen, Carlsbad, CA, USA) depending on the experimental requirements.
9
Culturing Esophageal Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human esophageal cancer cell lines Eca-109 were purchased from the Chinese Academy of Science Cell Bank. TE-1 and CaES-17 cells were purchased from Procell life Science&Technology Co.Ltd. (China). TE-1 and Eca-109 cells were cultured in RPMI-1640 (PM150110, Procell, China) plus 10% FBS (164210-500, Procell, China) and 1% P/S (PB180120, Procell, China) maintained at 37 °C with 5% CO2.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!