Generuler 100 bp dna ladder

For the ISSR analysis, 22 ISSR primers (Table 2) described by Farinhó et al. [29 (link)] were screened using a few DNA samples. The total reaction volume was 20 μl containing 40 ng template DNA, 0.2 mM of each dNTP, 0.5 μM decanucleotide primer, 1 U Taq DNA polymerase (Pharmacia Biotech), 1.5 mM MgCl₂, and 1× PCR buffer (10 mM Tris-HCl pH 9.0, 50 mM KCl). The PCR amplification was carried out in the Biometra UNO II thermocycler programmed as follows: an initial denaturation step of 4 min at 94°C followed by 40 cycles consisting of a denaturation step of 30 s at 94°C, a primer annealing step of 45 s at 52°C, and an extension step of 2 min at 72°C. The last cycle was followed by 7 min at 72°C for final extension. The amplification products were analysed by electrophoresis in 2% agarose gel in 0.5× TBE buffer and detected by ethidium bromide staining. The GeneRuler 100bp DNA ladder (MBI, Fermentas) was used to determine the size of the ISSR fragments.

Genomic DNA was extracted using a standard method^{51 (link)} or simple alkali isolation. In the alkali extraction, the animal tissue was immersed in 50 mM NaOH and subsequently vortexed. After heating for 10 min at 95 °C, the solution was neutralized using 1 M Tris-HCl, followed by centrifugation. Only the supernatant was used for the subsequent PCR experiments. Genomic DNA was used as the template for PCR to detect the transgene using the following primer: 5′-CTATGACTGGGCACAACAGACAAT-3′ (in the Neo resistance gene-coding region). To evaluate the effectiveness of recombination, DNA was extracted from homogenized whole brains. Each allele with/without a STOP sequence was PCR-amplified using either set of primers: pCX1624F, CTAGAGCCTCTGCTAACC and PGK-R, GACGTGCTACTTCCATTTGTCAC for the STOP-remaining allele (PCR product: 497 bp); or pCX1624F, CTAGAGCCTCTGCTAACC and ChR + 136 R, CTCGGTGGAAGACGTAATCAGG for the STOP-deleted allele (PCR product: 314 bp). The PCR fragments were amplified at 95 °C for 3 min, followed by 35 cycles at 95 °C for 30 sec, 60 °C for 30 sec, and 72 °C for 1 min using KOD FX Neo (TOYOBO, Osaka, Japan). GeneRuler 100 bp DNA ladder (Fermentas, Burlington, ON, Canada) was used as marker for electrophoresis.

PCR primers designed in this study were employed to amplify the sequence of the genes of the isolates. Amplification was carried out in a total reaction volume of 25 μL containing 2.5 μL 10x PCR buffer, 1.5 mM MgCl₂, 0.2 mM deoxynucleotide, 0.4 pmol/µL of each primer (Bioneer, Seoul, South Korea), 0.2 U Taq DNA polymerase, and 3 µL DNA. The thermocycler (Analytik Jena, model: Flex Cycler 96G) was set with the following conditions: initial denaturation for 2 min at 95°C, followed by 25 cycles of denaturation for 20 s at 94°C, annealing for 20 s at 58°C, an extension for 40 s at 72°C, and final extension for 1 min at 72°C. Electrophoresis was performed on a 1.5% agarose gel along with GeneRuler 100 bp DNA Ladder (Fermentas, Lithuania) and stained with 0.5 μg/mL ethidium bromide.
P. aeruginosa ATCC 27853 was used as a positive control in all experiments.

Total RNA was extracted and purified using TRIzol (Invitrogen). Total RNA (1 μg) was reverse-transcribed into cDNA using a mixture of oligo (dT) and Superscript II reverse transcriptase under the recommended conditions (Invitrogen) in a total volume of 20 μL for 50 min at 42°C, and terminated by a 15 min incubation at 70°C. PCR was performed in a 20-μL mixture containing 100 pM primer pairs, 1.0 μL cDNA, PCR buffer, dNTPs, and Taq DNA polymerase under the recommended conditions (Takara, Kyoto, Japan). Amplifications were carried out for 35 or 40 cycles depending on the target gene with the following thermocycler protocol: 15 s at 96°C, 30 s at 55°C or 57°C, and 60 s at 72°C. The final elongation time was 7 min at 72°C. Then, 6 μL of PCR product was analyzed by 1% agarose gel electrophoresis with ethidium bromide staining with a GeneRuler 100-bp DNA ladder (Fermentas, Ontario, Canada). The PCR primers were as follows: mouse TRIC sense: 5′-CTCGGAGACATCGGGAGTTC-3′, antisense: 5′-GCTGATCCCTCTGTCGATCACT-3′; mouse LSR sense: 5′-CGCAGAGCTCATTGTCCTTTGATTG-3′, antisense: 5′-GGAGGTTACTTCACTTCACTCATGGCCCG-3′; G3PDH sense 5′-ACCACAGTCCATGCCATCAC-3′, antisense 5′-TCCACCACCCTGTTGCTGTA-3′.

Five microliters of each reaction were run on conventional 2.5% agarose gel electrophoresis with ethidium bromide (0.5 μg/ml) in TAE buffer (40 mM Tris-Acetate (pH 8.3), 2 mM EDTA). Electrophoresis was done for 2 h in electric field strength of 40 V/cm gel and the DNA was visualized under UV light-transilluminator light (Bio-Rad). The GeneRuler 100 bp DNA ladder (Fermentas) was run on each gel to estimate the size of the PCR products.

The products of PCR were separated by electrophoresis on 1% agarose gel (Applichem, Germany, GmbH) in 1x TBE buffer at room temperature using gradients of 5 V/cm. For gel analysis, 20 µL of the PCR products were loaded in each gel slot. Gene ruler 100 bp DNA ladder (Fermentas, Sigma) was used to determine the fragment sizes. The gel was photographed by a gel documentation system (Alpha Innotech, Biometra) and the data were analyzed through computer software.