Abi prism 5700 sequence detection system

Total RNA was prepared from mouse brain and Oli-neu cell line using the Tri-reagent (Sigma) according to the manufacturer's protocol. Approximately 1 µg total RNA of each sample was reverse transcribed using the M-MLV Reverse Transcriptase (Promega) and random primers in a 20 µl reaction mixture. The reverse transcription reactions were carried out at 42°C for 30 min. For each gene, the real-time PCR analysis was performed in triplicates with 2 µl of the cDNA, primers (Table S2) at a concentration of 0.3 µM. The SYBR Green (Applied Biosystems) was added to the 20 µl reaction mixture. An ABI PRISM 5700 Sequence Detection System (Applied Biosystems) was programmed as follows: one cycle of 10 min at 95°C, followed by 40 cycles of 15 s at 95°C and 1 min at 60°C. Data were analyzed using the 7500 SDS system software. To control for the amount of RNA, amplification of TBP was performed and corrected for each cDNA sample.
Relative expression results are presented as changes in the threshold cycle (ΔΔCt). The threshold cycle refers to the PCR cycle at which the extent of fluorescence is increased to a calculated level above background. Statistical analysis was undertaken using Prism (GraphPad Software, Inc). The significance was set at P<0.05.

Total RNA was isolated according to the instructions of TRIzol reagent (Invitrogen) and subsequently reverse-transcribed into the first-strand cDNA via a PrimeScript RT reagent kit (Takara Bio, Shiga, Japan). qRT-PCR was carried out with SYBR Green kit (Takara Bio) on an ABI Prism 5700 Sequence Detection System (Applied Biosystems, Foster City, CA, U.S.A.). Experimental processes were implemented in-line with the manuals. GAPDH or U6 was used as the internal control and relative gene expressions were determined by the 2^−ΔΔC_t approach. qRT-PCR assay was conducted in triplicate.

cDNA was prepared from 100 ng of total RNA isolated with the Qiagen RNeasy mini-column kit (Qiagen, GmbH, Germany) using Superscript II reverse transcriptase (Invitrogen) and random primers. Human ribosomal protein L32 mRNA was used as a housekeeping gene for normalization [34 (link)]. qRT-PCR was performed on an ABI Prism 5700 Sequence Detection System (Perkin-Elmer Applied Biosystems, Australia) with cDNA generated from an equivalent of 2 ng of RNA as previously described [24 (link)]. The primer sequences used were for L32: CAGGGTTCGTAGAAGATTCAAGGG and CTTGGAGGAAACATTGTGAGCGATC; α1 integrin: GCTGACCAGTCAGCAGCTTCATTT and CTCCAGAAGAAGCAGTAGCAGAGTTT; α2 integrin: GACCTATCCACTGCCACATGTGAAAAA and CCACAGAGGACCACATGTGAGAAAA; α3 integrin: CGCAGGTGGGCGCCTATTTT and GGCACCCCCTACTTCCTCTTT; αV integrin: GGCAGTGC CATAGCTCCTTT and CCCACTGCCCTTCAAGGGATTT; β1 integrin: GACTGATCAGTTCAGTTTGCTGT GTGTTT and CCCTGCTTGTATACATTCTCCACATGATTT. Reaction conditions were 95°C for 10 minutes followed by 50 cycles of 95°C for 15 s and 60°C for 1 minute. The difference in average cycle threshold (dCT) between L32 (housekeeping) and the gene of interest was determined from quadruplicate readings for each sample.

Total RNA from serum and H9C2 cells was extracted using TRIzol reagent (Invitrogen). cDNAs were synthesized using TaqMan miRNA Reverse Transcription Kit (Applied Biosystems, U.S.A.).
Quantitative real-time PCR (qRT-PCR) reactions were performed using ABI Prism 5700 Sequence Detection System (Applied Biosystems). U6 snRNA served as an internal normalized reference for miR-25, and β-actin used as an internal control for PTEN and TLR4. The 2^−ΔΔC_t method was used to calculated target genes expression.

Total RNA of epSPCi at the indicated points of the OPC differentiation process was extracted by using the RNeasy Mini-kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. One microgram of total RNA was reverse-transcribed in a total reaction volume of 50 μL at 42 °C for 30 min using random hexamer primers. For quantitative analyses, we used LightCycler SYBR^® Green I technology, and the relative expression of mRNA transcripts was analyzed by the ABI PRISM 5700 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). As a template, we used 40 ng of cDNA to analyze the expression of target and housekeeping genes (18S) in separate tubes for each pair of primers. The sequences from 5′ to 3′of each pair of primers are: rNG2, forward primer: 5′-ATGCTTCTCAGCCCGGGACA-3′; reverse primer: 5’-GGTTGCGGCCATTGAGAATG-3’; r18S, forward primer: ggaagggcaccaccaggagt; reverse primer: tgcagccccggacatctaag. The comparative threshold cycle (Ct) method was used to calculate the relative expression as follows:

ΔC_t for FM19G11-treated samples was then subtracted from the ΔC_t for vehicle-treated samples, to generate ΔΔC_t (ΔΔC_t = ΔC_t (FM19G11) − ΔC_t (vehicle)). The mean of these ΔΔC_t measurements was used to calculate the fold change in gene expression (2 ^−ΔΔCt). Results were presented as the mean ± standard error.

Total RNA was extracted with the TRIzol reagent (Invitrogen, Carlsbad, U.S.A.). Then, 2 μg RNA was reverse transcribed into the first-strand cDNA using PrimeScript RT reagent kit (Takara Bio Inc., Shiga, Japan). Quantitative reverse transcription-PCR (qRT-PCR) were performed by using an ABI Prism 5700 Sequence Detection System (Applied Biosystems). All procedures were performed according to the manuals. The relative gene expression was determined with the 2^−ΔΔCt approach.