Primary cell 4d nucleofector kit

For experiments involving the reduction of PIEZO1 expression, unstimulated macrophages were exposed to non-target and PIEZO1 siRNA (both Dharmacon) in a Nucleofector^® solution obtained from a primary cell 4D-Nucleofector^® kit (Lonza). Following transfection, the cells were supplemented with warm media before being seeded onto experimental substrates. The transfected cells were allowed to adhere for 72 h prior to stimulation for an additional 18 h.

To generate JunD KO cells, the electroporation method was used. CRISPR/Cas9 gene editing was conducted by electroporation Cas9/gRNA (RNP) complex using 4D-Nucleofector System N (Lonza), Primary cell 4D-nucleofector kit (Lonza). Briefly, RNP containing 6 μg Cas9 protein and 6 μg sgRNA was precomplexed for 30 minutes at room temperature to create RNP complex as previously described (31 (link)). The mixture of RNP and activated TCR_OT-I T cells were transferred into the electroporation cuvette using the EO-115 program in 16-well cuvette strips. T cells were recovered in 200 μL preheated T cell medium and expanded as described above. Gene KO efficiency was detected using Tracking Indels by Decomposition, or TIDE. The JunD sgRNAs were sg1 CCGTCGGGGCGCAGCGCAGA, sg2 CGCTCGACGCACCCGCAGCC, sg3 GAGCGGCGGGATTGAAACCA, sg4 CGGGTAGAGGAACTGCGTAC, and sg5 GGATGGAAACGCCCTTCTAT, and sg2 was chosen in the functional experiments.