Mouse monoclonal anti xpress

Following the binding assay described above, cells were fixed with methanol for 5min at -20°C. After washing with PBS, cells were blocked with 3% BSA in PBS for 1h at RT and incubated with mouse monoclonal anti-Xpress (1:2000, Invitrogen, Life Technologies, Carlsbad, CA, USA) overnight at 4°C. After washing, cells were incubated with Alexa Fluor 488-conjugated goat anti-mouse IgG (1:2000, Invitrogen, Life Technologies, Carlsbad, CA, USA) for 1h at RT. After washing off the secondary antibody, cells were stained with 4'6-diamidino-2-phenylindole (DAPI; Roche Diagnostics GmbH, Vienna, Austria) and Whole Cell Stain (Invitrogen, Life Technologies, Carlsbad, CA, USA). Following a final washing step, cells were mounted in ibidi Mounting Medium (Ibidi GmbH, Munich, Germany). Binding and internalization of proteins were examined using a Zeiss Axiovert 200 M fluorescence microscope or a Zeiss 510 Meta confocal microscope (Zeiss, Jena, Germany).

cDNAs for human ISG15 and UBCH8 and mouse UBP43 were subcloned into pFlag-CMV10 vector and/or pcDNA3-Myc vector32 (link). Human p53 cDNAs were obtained from Korean human gene bank. p53, its deletion constructs, and K-to-R mutants were subcloned into pcDNA3-HA vector and pcDNA-HisMax vector (Invitrogen)67 (link). Site-directed mutagenesis was performed as recommended by the manufacturer's instructions (Stratagene).
Antibodies used were mouse monoclonal anti-Xpress (Catalogue number P/N 46-0528, Invitrogen), mouse monoclonal anti-Flag M2 (F3165, Sigma), mouse monoclonal anti-Myc (9E10, Santa Cruz), mouse monoclonal anti-p53 (DO-1, Santa Cruz), rabbit polyclonal anti-p21 (C-19, Santa Cruz), mouse monoclonal anti-β-actin (C4, Santa Cruz), rabbit anti-phospho-p53 (9284S, Cell Signaling) and rabbit anti-acetyl-p53 (2525S, Cell Signaling). Polyclonal anti-ISG15 antibody was generated by injecting purified ISG15 protein to rabbit32 (link). shRNA were purchased from Open Biosystems. Target sequences of shRNAs for ISG15 and EFP are: 5′- CTGAGCATCCTGGTGAGGAAT -3′ for ISG15; 5′- GAACTCATCTTTGCCAGTA -3′ (5′-UTR (untranslated region) for ISG15; 5′- GAGTGAGATCCAGACCTTGAA -3′ for EFP; 5′- GCAGAACTCTCCTTGGATA -3′ (3′-UTR) for EFP. All antibodies were diluted 1:1,000 with PBS containing 0.1% Triton X-100 and 3% BSA, except anti-β-actin, which was diluted 1:2,500.