Total RNA was extracted from cells in the different treatment groups using TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc.) and then reverse-transcribed to cDNA using a Reverse Transcription Kit (cat. no. RR047A; Takara Bio, Inc.). The cDNA was then used as the template for qPCR using a SYBR Premix Ex Taq kit (Takara Bio, Inc.) on an Applied Biosystems Real-time PCR System (Thermo Fisher Scientific, Inc.). The thermocycling conditions were as follows: 95°C for 30 sec; followed by 40 cycles of denaturation at 95°C for 5 sec and annealing at 60°C for 30 sec. GAPDH was used as an internal control. Relative RNA expression levels were calculated by the 2−ΔΔCq method (33 (link)). The primer sequences were as follows: IDO1 forward, 5′-GCC TGA TCT CAT AGA GTC TG GC-3′ and reverse, 5′-TGC ATC CCA GAA CTA GAC GTG C-3′; GAPDH forward, 5′-GTC TCCT CTG ACT TCA ACA GCG-3′ and reverse, 5′-ACC ACC CTG TTG CTG TAG CCA A-3′.
Applied biosystems real time pcr system
Manufactured by Thermo Fisher Scientific
Sourced in United States, China
The Applied Biosystems Real-time PCR System is a laboratory instrument designed for DNA amplification and quantification. It utilizes real-time polymerase chain reaction (PCR) technology to detect and measure the presence of specific nucleic acid sequences in a sample.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (9 mentions)
Primescript rt reagent kit, by Takara Bio (4 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (4 mentions)
Reverse transcription kit, by Thermo Fisher Scientific (4 mentions)
Sybr premix ex taq kit, by Takara Bio (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Superscript 3, by Thermo Fisher Scientific (2 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Trizol regent, by Thermo Fisher Scientific (1 mentions)
Tb green premix ex taq 2 kit, by Takara Bio (1 mentions)
Primescript rt master mix, by Takara Bio (1 mentions)
Rnaiso plus, by Takara Bio (1 mentions)
96 well pcr plate, by Thermo Fisher Scientific (1 mentions)
Oligo dt, by Thermo Fisher Scientific (1 mentions)
Rtn350, by Merck Group (1 mentions)
High capacity cdna reverse transfection kit, by Thermo Fisher Scientific (1 mentions)
Taqman real time pcr probes, by Thermo Fisher Scientific (1 mentions)
Ampd1, by Merck Group (1 mentions)
Genejet rna purification kit, by Thermo Fisher Scientific (1 mentions)
22 protocols using applied biosystems real time pcr system
1
Quantitative Reverse Transcription PCR for Gene Expression
2
Quantitative Analysis of Lipid Metabolism Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of the above cultured MDA-MB-231 cells was isolated using TRIzol regent (Invitrogen, USA). And then 1 mg of RNA was treated with genomic DNase and retro-transcripted using PrimeScript RT reagent Kit (RR037A, Takara, China). qPCR was performed in triplicate using 25 ng of cDNA with validated qPCR primers, TB Green Premix Ex Taq II Kit (RR820A, Takara, China), and Applied Biosystems Real-time PCR System (QSDX, Thermo Fisher, USA). The reaction was performed according to the manufacturer’s protocol using QSDX Real-time PCR System. Data were analyzed following the 2−∆∆Ct method. The Ct values of the genes of interest were normalized to the Ct value of the housekeeping control, GAPDH. The primers used for qPCR are listed below. Acetyl-CoA carboxylase alpha (ACACA): forward 5ʹ-ATGTCTGGCTTGCACCTAGTA-3ʹ, reverse 5ʹ-CCCCAAAGCGAGTAACAAATTCT-3ʹ; hydroxymethylglutaryl-CoA reductase (HMGCR): forward 5ʹ-TGATTGACCTTTCCAGAGCAAG-3ʹ, reverse 5ʹ-CTAAAATTGCCATTCCACGAGC-3ʹ; RARRES2: forward 5ʹ-AGAAACCCGAGTGCAAAGTCA-3ʹ, reverse 5ʹ-AGAACTTGGGTCTCTATGGGG-3ʹ; chemokine-like receptor-1 (CMKLR1): forward 5ʹ-GCCAACCTGCATGGGAAAATA-3ʹ, reverse 5ʹ-GTGAGGTAGCAAGCTGTGATG-3ʹ; fatty acid synthase (FASN): forward 5ʹ- AAGGACCTGTCTAGGTTTGATGC-3ʹ, reverse 5ʹ-TGGCTTCATAGGTGACTTCCA-3ʹ.
3
Quantifying CUEDC2 mRNA in Colorectal Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To investigate levels of CUEDC2 mRNA in different types of colorectal cancer cells, total RNA was extracted from fresh colorectal cancer tissue (200 mg per sample) and human colorectal cancer cells (1 × 106 cells/cm2) using RNAiso™ Plus (Takara Bio, Kusatsu, Shiga, Japan) according to the manufacturer’s instructions. Total RNA was synthesized to cDNA by reverse transcription using PrimeScript™ RT Master Mix (Takara) according to the manufacturer’s instructions. The cDNA was then used as a template for real-time PCR amplification of CUEDC2. Each 20 µl reaction mix contained the following: 10 µl SYBR Premix Ex Taq™ II (with dNTPs; Takara), 2 µl cDNA, 7.2 µl ddH2O and 0.2 µmol/l of the following primers: CUEDC2 forward GATGCCAGGAACAAAGAGAA and reverse CTCATCTTGGGTGTCTGC; or GAPDH forward GAAGGTGAAGGTCGGAGTC and reverse GAAGATGGTGATGGGATTTC as internal control. The PCR reactions were performed using an Applied Biosystems real-time PCR system (ThermoFisher Scientific, Waltham, MA, USA) and the following cycling programme: preliminary denaturation at 95°C for 30 s, followed by 40 cycles of denaturation at 95°C for 5 s, annealing at 60°C for 34 s, and elongation at 72°C for 10 s. The mRNA levels were analysed using the comparative Ct method (2-△△Ct). The experiment was repeated three times for each tissue sample and each cell line.
4
Quantitative Analysis of EGFR and B7H5 in NSCLC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from NSCLC cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) and then reverse-transcribed to cDNA using a Reverse Transcription Kit (cat. no. RR047A; Takara Bio, Inc.). The cDNA was then used as the template for the qPCR step of the RT-qPCR protocol using a SYBR Premix Ex Taq kit (Takara Bio, Inc.) on an Applied Biosystems Real-time PCR System (Thermo Fisher Scientific, Inc.). The thermocycling conditions were as follows: 95°C for 30 sec, followed by 40 cycles of denaturation at 95°C for 5 sec and annealing at 60°C for 30 sec. β-actin was used as a reference control. The results were analyzed using the 2−ΔΔCq method (20 (link)). The primers used were as follows: EGFR forward, 5′-CAG ATC GCA AAG GGC ATG AA-3′ and reverse, 5′-TTG CCT CCT TCT GCA TGG TA-3′; B7H5 forward, 5′-AGG GGG CAT CTC TGT ACA CT-3′ and reverse, 5′-GGC TGG ACT ATG CTC TCC AC-3′; β-actin forward, 5′-GAC TTA GTT GCG TTA CAC CCT T-3′ and reverse, 5′-ACC TTC ACC GTT CCA GTT TT-3′.
5
Thermal Shift Assay for M. smegmatis MshC Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The binding affinity of the synthesized compounds to M. smegmatis MshC (Ms-MshC) was evaluated by applying a fluorescence-based thermal shift assay (TSA). A 20 μL reaction system containing 0.2 mg/mL protein, 1× thermal shift dye (ThermoFisher Scientific, Waltham, MA, USA), 50 mM HEPES pH 7.0, 150 mM KCl, 10% (v/v) ethylene glycol and various concentrations of each compound was prepared in 96-well PCR plates (ThermoFisher Scientific, Waltham, MA, USA) on ice. The plates were centrifuged to remove air bubbles and then measured by using the Applied Biosystems real-time PCR system (ThermoFisher Scientific, Waltham, MA, USA) with an excitation filter of 580 ± 10 nm and an emission filter of 623 ± 14 nm. The plates were gradually heated from 4 °C to 95 °C at a rate of 0.05 °C/s. The melting curves were fitted with a Boltzmann model using the Protein Thermal Shift software to calculate the protein melting temperature (Tm). Due to the compounds containing a cysteine group, which is easily oxidized, forming a disulfide, the reducing agent TCEP (1 mM) was added to eliminate the effects of oxidation. The compared results are shown in Table 1 . Triplicate assays were applied to controls, and all compounds and the averaged Tm were used.
6
RNA Isolation and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using a mammalian total RNA isolation kit (RTN350, Sigma) and treated with Dnase I (AMPD1, Sigma) according to the manufacturer’s instructions. Equal microgram volumes of RNA were reverse transcribed for each experimental condition by the use of a High-Capacity cDNA reverse transfection kit (4368813, ThermoFisher Scientific) with oligo dT (12577–011, ThermoFisher Scientific). The resulting cDNA was used for expression analysis performed with an Applied Biosystems real-time PCR system with TaqMan real-time PCR probes (Thermo Fisher). The TaqMan qPCR probes were as follows: COX6B2 (Hs00376070_m1), COX6B1 (Hs01086739_g1). RPL27 (Hs03044961_g1) was used as an internal loading assay for all expression assays.
7
Quantitative gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells (1.5x106) using a TRIzol® reagent (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocols. Subsequently, RNA was reverse transcribed into cDNA using the PrimeScript RT Reagent kit (Takara Bio, Inc.) according to the manufacturer's protocols. The expression levels of the target gene were quantified with real-time PCR using the SYBR-Green PCR Master Mix (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. qPCR was performed on the Applied Biosystems real time PCR system (Thermo Fisher Scientific, Inc.) and the gene expression levels were quantified using the 2-ΔΔCq method (19 (link)). The following thermocycling conditions for qPCR were used: Initial denaturation at 95˚C for 5 min; 40 cycles of denaturation at 95˚C for 10 sec, and annealing and extension at 60˚C for 45 sec. The following primers were used: NLRC5 forward, 5'-TGAGGGAGTCTGCACTATGGA-3' and reverse, 5'-TCCGATTCAGGGCTCAGGTA-3'; YY1 forward, 5'-TCAGACAAGTCACGTCAGGC-3' and reverse, 5'-CTCCATGTGTCACCTCCCAC-3'; and GAPDH forward, 5'-CGGAGTCAACGGATTTGGTCGTAT-3' and reverse, 5'-AGCCTTCTCCATGGTGGTGAAGAC-3'.
8
Validating miRNA Expression in Plasma Exosomes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The initial miRNA microarray results from the plasma exosomes samples were validated using RT-qPCR. Exosome and tissue miRNA purification and RT-qPCR were performed as described previously (18 (link)). Briefly, total RNA from stored plasma exosome and tissue samples was extracted using TRIzol reagent (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocols. RT-qPCR was performed using SYBR Green and detected using the Applied Biosystems Real-Time PCR system (Thermo Fisher Scientific, Inc.). Each sample was analyzed in triplicate. The primers used for RT-qPCR are listed in Table I . The U6 small nuclear RNA was used as an internal control. The results were quantified using the 2−ΔΔCq method (19 (link)) and normalized to U6 expression.
9
Quantitative Real-time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using GeneJET RNA Purification kit (Thermo Fisher Scientific, Inc., Waltham, MA, USA), according to manufacturer’s instruction, and then reverse-transcribed in 20 μL volume using RevertAid First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Inc., Waltham, MA, USA). Real-time PCR was carried out using Applied Biosystems® Real-time PCR system (Thermo Fisher Scientific, Inc., Waltham, MA, USA) with BeyoFast™ SYBR Green qPCR Mix (2X, Low ROX) (Beyotime Biotechnology, Nantong, China), forward and reverse primers in a final PCR reaction volume of 20 μL. Amplification was performed according to the manufacturer’s recommendation. The primers used in the present study are listed in Table 1 .
10
Quantitative PCR for Inflammatory Cytokines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA that extracted from cells with Trizol method (Invitrogen) was reversely transcribed into cDNA using a PrimeScript™ RT Reagent Kit (TAKARA Bio Inc. Shiga, Japan). After reverse transcription, expression of the target gene was quantified by real-time PCR with a SYBR™ Green PCR Master Mix (Invitrogen) in light of recommended instructions. RT-qPCR was performed with an Applied Biosystems™ real time PCR system (Thermo Fisher Scientific). The data were quantified using the 2–ΔΔCt method.13 (link) The sequences were as follows: IL-1β sense: 5′- CCAAACCTCTTCGAGGCACA −3′, antisense: 5′- AGCCATCATTTCACTGGCGA −3′; IL-6 sense: 5′-GTCCAGTTGCCTTCTCCCTGG-3′, antisense: 5′- CCCATGCTACATTTGCCGAAG-3′; IL-10 sense: 5′- TGCTCTTGCAAAACCAAACCA-3′, antisense: 5′- GGGAGGTCAGGGAAAACAGC-3′; TGF-β sense: 5′-ACCTGCCACAGATCCCCTAT-3′, antisense: 5′- GAGCAACACGGGTTCAGGTA-3′; CD11b sense: 5′- GCTTTGGTGGCTTCCTTGTG-3′, antisense: 5′-TAGTCGCACTGGTAGAGGCT-3′; CD18 sense: 5′- CAGGGCAGACTGGTAGCAAA-3′, antisense: 5′- GCGTCACTTTTTGTGGGGAC-3′; GAPDH sense: 5′- AATGGGCAGCCGTTAGGAAA-3′, antisense: 5′- GCGCCCAATACGACCAAATC-3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!