Specific sirna

Manufactured by Santa Cruz Biotechnology

Sourced in United States

Specific siRNAs are short, double-stranded RNA molecules that can be used to selectively silence the expression of target genes. These siRNAs are designed to target specific mRNA sequences, leading to their degradation or translational repression, thereby reducing the production of the corresponding protein.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

SiRNAs specific for human Target-specific 19–25 nt siRNAs Prolidase-specific siRNAs Small-interfering RNA (siRNA) specific P53-specific siRNA Gene-specific siRNA Small interfering RNA (siRNA) specific for Src ACTA2-specific siRNA (sc-43591) Non-specific control siRNA Nrf2 specific siRNA

18 protocols using specific sirna

PLC-β2 Overexpression and Downmodulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

PLC-β2 over-expression was performed by transient transfection with a plasmid expressing a full-length human PLC-β2 and the specific down-modulation of the PLC was achieved by using specific siRNAs (Santa Cruz Biotechnology), following previously described procedures [18 ]. An empty vector and a non-silencing scramble siRNAs, respectively, were used as negative controls. The transfected cells were incubated at 37 °C in a 5% CO₂ atmosphere for 48 h then subjected to RTCA and to cytofluorimetrical analysis.

Brugnoli F., Grassilli S., Lanuti P., Marchisio M., Al-Qassab Y., Vezzali F., Capitani S, & Bertagnolo V. (2017). Up-modulation of PLC-β2 reduces the number and malignancy of triple-negative breast tumor cells with a CD133+/EpCAM+ phenotype: a promising target for preventing progression of TNBC. BMC Cancer, 17, 617.

+ Open protocol

+ Expand

Silencing Calpain 1 in Podocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Specific siRNAs targeting mouse calpain 1 and a non-targeted control siRNA were purchased from Santa Cruz Biotechnology (Santa Cruz, USA). Podocytes were seeded in a 6-well culture dish, and siRNA duplexes were diluted in 100 μl of serum-free medium. Then, 6 μl of Lipofectamine 2000 (Invitrogen, USA) was added to 100 μl of the siRNA duplexes. The duplexes were incubated for 15 min and subsequently added to each well. After 48 h of transfection, the cells were treated using the appropriate methods. After the cells were lysed in RIPA, Western blots were performed to examine protein levels.

Ding F., Li X., Li B., Guo J., Zhang Y, & Ding J. (2016). Calpain-Mediated Cleavage of Calcineurin in Puromycin Aminonucleoside-Induced Podocyte Injury. PLoS ONE, 11(5), e0155504.

+ Open protocol

+ Expand

Gain- and Loss-of-Function Studies of MDM2

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Based on the expression of MDM2 in LAC cell lines, we selected PC9 cells for gain-of-function studies and the H1975 cells for loss-of-function studies. The lentivirus-packaged MDM2 overexpression vector, MDM2-shRNA, and all negative controls were constructed and verified as previously described.28 (link) These procedures were performed by GenePharma (Shanghai, China). Stably transfected cell lines were screened with 0.6 μg/mL puromycin (Sigma). Knockdown of Smad2 and Smad3 in H1975 cells was performed by transfecting cells with specific siRNAs (Santa Cruz, CA, USA). DNA sequences used in this study are given below. Scrambled negative siRNA sequence: 5′-TTC TCC GAA CGT GTC ACG UTT-3′; Smad2 siRNA: 5′-AUC UAA UCG UCC UGU UUU CUU TT-3′; Smad3: 5′-UCU UCU UGA GUU UCU UGA CCA TT-3′; MDM2 shRNA: 5′-UUG GUA UUG CAC AUU UGC CUG-3′. Lipofectamine 2000 reagents (Invitrogen) were used for cell transfection according to the manufacturer’s instructions.

Tang Y., Xuan Y., Qiao G., Ou Z., He Z., Zhu Q., Liao M, & Yin G. (2019). MDM2 promotes epithelial–mesenchymal transition through activation of Smad2/3 signaling pathway in lung adenocarcinoma. OncoTargets and therapy, 12, 2247-2258.

+ Open protocol

+ Expand

Generating E-Cadherin Knockdown Cells Using Lentiviral shRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

To produce lentivirus expressing shRNA for pLKO‐shE‐cadherin or pLKO‐empty plasmids were co‐transfected with the lentivirus packaging plasmids (psPAX2, pMD2G, and VSV‐G) into 293T cells. The virus containing cell culture supernatant was harvested, filtered through a 0.22‐μm pore‐size filter and used to infect EC96 cells. To generate stable E‐cadherin knockdown cells, infected cells were selected by puromycin (2 μg/mL) for 1 month.
Specific siRNAs, targeting NF‐κB, and non‐specific control siRNAs were purchased from Santa Cruz Biotechnologies. For transient transfection, cells were seeded at a density of 5 × 10⁴ cells/mL in antibiotic‐free medium, and siRNAs were transfected using the transfection reagent (Santa Cruz Biotechnology), according to the manufacturer's instructions. After incubation for 72 h, the cells were analyzed using BrdU or immunoblot assay.

Park S.Y., Shin J, & Kee S. (2017). E‐cadherin expression increases cell proliferation by regulating energy metabolism through nuclear factor‐κB in AGS cells. Cancer Science, 108(9), 1769-1777.

+ Open protocol

+ Expand

Raptor and Rictor Knockdown in Podocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Specific siRNAs targeting mouse raptor and rictor (each siRNA product consists of a pool of 3 target-specific 19–25 nt siRNAs designed to knock down the gene expression) and non-targeted control siRNA were purchased from Santa Cruz (Santa Cruz, USA). Podocytes were seeded on a 6-well culture dish or coverslips on the preceding day to reach 50–60% confluence at the time of transfection. For each well, siRNA duplexes were diluted into 100 µl of serum-free medium. Then, 6 µl of lipofectamine 2000 (Invitrogen, USA) was added to 100 µl of the siRNA duplexes. The duplexes were incubated for 15 minutes and added to each well. After 48 hours of transfection, the cells were lysed for Western blotting or were used for calcium imaging.

Ding F., Zhang X., Li X., Zhang Y., Li B, & Ding J. (2014). Mammalian Target of Rapamycin Complex 2 Signaling Pathway Regulates Transient Receptor Potential Cation Channel 6 in Podocytes. PLoS ONE, 9(11), e112972.

+ Open protocol

+ Expand

Evaluating TMPRSS2, IGF-1R, and ERs in PC-3 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Before treatment with E₂, the medium was changed to RPMI supplemented with 10% CS-FBS. PC-3 cells were transiently transfected with control non-targeting siRNA or specific siRNAs targeting TMPRSS2, IGF-1R, or ETVs (Santa Cruz Biotechnology, CA, USA). In another set of experiments, PC-3 cells were transfected with a control shRNA plasmid, shRNA targeting ERβ or ERα using Lipofectamine 2000, according to the manufacturer's instructions (Invitrogen).

Kim H., Datta A., Talwar S., Saleem S.N., Mondal D, & Abdel-Mageed A.B. (2016). Estradiol-ERβ2 signaling axis confers growth and migration of CRPC cells through TMPRSS2-ETV5 gene fusion. Oncotarget, 8(38), 62820-62833.

+ Open protocol

+ Expand

Silencing LKB1 and SLC7A11 in FLS

Check if the same lab product or an alternative is used in the 5 most similar protocols

Specific siRNAs targeting human LKB1 or SLC7A11 were purchased from Santa Cruz Biotechnology (Dallas, TX, USA). Scramble siRNA (Santa Cruz Biotechnology) was used as the control. FLS were transfected with Lipofectamine 3000 transfection reagent (Invitrogen, Carlsbad, CA, USA) and the indicated siRNA constructs. After incubation for 24 h, target gene expression was evaluated by RT-PCR or western blot analysis.

Lee H.R., Yoo S.J., Kim J, & Kang S.W. (2023). LKB1 Regulates Inflammation of Fibroblast-like Synoviocytes from Patients with Rheumatoid Arthritis via AMPK-Dependent SLC7A11-NOX4-ROS Signaling. Cells, 12(9), 1263.

+ Open protocol

+ Expand

Lentiviral-Mediated Knockdown of ZO-1 and CLDN7 in EC96 Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lentivirus expressing shRNA for pLKO-shZO-1 or pLKO-shCLDN7 were purchased from sigma. To produce lentivirus expressing shRNA co-transfected with the lentivirus packaging plasmids (psPAX2, pMD2G, and VSV-G) into 293T cells. The virus-containing cell culture supernatant was harvested, filtered through a 0.22-μm pore-size filter, and used to infect EC96 cells. To generate stable ZO-1 and CLDN7 knockdown cells, infected cells were selected by puromycin (2 μg/mL), and several rounds of single-cell cloning. The establishment of E-cadherin knockdown EC96 stable cell lines were described previously [27 (link)].
Specific siRNAs, targeting ZO-1, CLDN1 CLDN7, and non-specific control siRNAs were purchased from Santa Cruz Biotechnologies. For transient transfection, cells were seeded at a density of 5 × 10⁴ cells/mL in an antibiotic-free medium, and siRNAs were transfected using the transfection reagent (Santa Cruz Biotechnology, Dallas, TX, USA), according to the manufacturer’s instructions. After incubation for 48 h, the cells were analyzed using in vitro wound-healing assay.

Park S.Y., Jang H., Kim S.Y., Kim D., Park Y, & Kee S.H. (2021). Expression of E-Cadherin in Epithelial Cancer Cells Increases Cell Motility and Directionality through the Localization of ZO-1 during Collective Cell Migration. Bioengineering, 8(5), 65.

+ Open protocol

+ Expand

Regulation of p120-catenin by Src

Check if the same lab product or an alternative is used in the 5 most similar protocols

The anti-pY228-p120-catenin antibody was purchased from BD Bioscience (#612537). The anti-GTP-RhoA antibody was purchased from NewEast (#26904). The anti-p120-catenin (#59854), anti-snail (#3879), anti-c-myc (#9402), anti-E-cadherin (#14472), anti-β-actin (#4970), anti-RhoA (#2117), anti-ROCK1 (#4035), and anti-Src (#2109) antibodies were purchased from Cell Signaling Technology.
The full-length coding regions of human p120-catenin were cloned into pCDNA3.1 vector by Genephama (Shanghai, China), which was used for overexpressing p120-catenin in SW480 cells. The mutation of Y228F and Y228E was generated based on site-directed mutagenesis strategy by Genephama. The c-Src construct was purchased from Addgene (#42205). All plasmid constructs were verified by DNA sequencing. Knockdown of Src was achieved by using specific siRNA from Santa Cruz Biotechnology (#sc-29228).

Ding X., Wang X., Lu S., Gao X, & Ju S. (2019). P120-Catenin And Its Phosphorylation On Tyr228 Inhibits Proliferation And Invasion In Colon Adenocarcinoma Cells. OncoTargets and therapy, 12, 10213-10225.

+ Open protocol

+ Expand

Lentiviral Overexpression of miR-26a in Multiple Myeloma

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lentivirus packaging and infection of MM cells were performed using pPACKH1 HIV Lentivector Packaging kit according to the manufacturer’s protocol (System Biosciences). MiR-26a over-expression or control plasmid (System Biosciences) was transfected with packaging plasmids into 293T cells using Lipofectamine 2000 (Thermo Fisher Scientific), which were labeled as V-miR-26a-GFP and V-GFP, respectively. Lentiviral particles were then collected from the culture supernatant at 48 h intervals and filtered with 0.22 μm filters. To obtain stable cell lines overexpressing miR-26a, MM cells were infected with recombinant lentivirus in the presence of polybrene overnight; GFP-positive cells were sorted by flow cytometry 4 days after infection. The expression levels of miR-26a in stable clones and transiently transduced cells were verified with real-time reverse transcriptase quantitative PCR (qRT-PCR). CD38 was knocked down using specific siRNA (Santa Cruz Biotechnology), and protein levels were detected by western blot.
To obtain CD38 overexpression vector, full length of CD38 ORF was cloned into pCDH-MSCV-MCS-EF1-copGFP-T2A-Puro plasmid (System Biosciences) between Xba I and Not I sites. Primer sequences were:

CD38-Xba-F: TTATCTAGATGGCCAACTGCGAGTTCAGCC

CD38-Not-R: ATAAGAATGCGGCCGCTCAGATCTCAGATGTGCAAGATGAATCCTC

Hu Y., Liu H., Fang C., Li C., Xhyliu F., Dysert H., Bodo J., Habermehl G., Russell B.E., Li W., Chappell M., Jiang X., Ondrejka S.L., Hsi E.D., Maciejewski J.P., Yi Q., Anderson K.C., Munshi N.C., Ao G., Valent J.N., Lin J, & Zhao J. (2020). Targeting of CD38 by the tumor suppressor miR-26a serves as a novel potential therapeutic agent in multiple myeloma. Cancer research, 80(10), 2031-2044.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!