Abi7300 pcr

Manufactured by Thermo Fisher Scientific

The ABI7300 PCR is a real-time PCR (Polymerase Chain Reaction) instrument designed for gene expression analysis, SNP genotyping, and other molecular biology applications. It provides accurate and reliable quantification of nucleic acid samples. The instrument utilizes fluorescence-based detection technology to measure the amplification of DNA or RNA targets during the PCR process.

Automatically generated - may contain errors

Lab products found in correlation

Rneasy mini kit, by Qiagen (2 mentions) Universal probe library based assays, by Roche (2 mentions) Omniscript rt, by Qiagen (1 mentions) Taqman assay reagent, by Thermo Fisher Scientific (1 mentions) Omniscript reverse transcriptase, by Qiagen (1 mentions) Rneasy column, by Qiagen (1 mentions) Viia7, by Thermo Fisher Scientific (1 mentions) Taqman universal pcr master mix, by Thermo Fisher Scientific (1 mentions)

3 protocols using abi7300 pcr

Quantitative real-time PCR for stem cell gene expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Equivalent numbers of EBs were collected in 100–200 μl of commercially available (Qiagen) RLT buffer at intended time points. RNAs were isolated using Qiagen RNeasy Mini Kit (Qiagen 74104) and cDNA was synthesized using Omniscript RT (Qiagen 205111). Taqman Assay reagents (Universal PCR 2X master mix; Applied Biosystems 4304437) were used for all targets. The reactions were quantified using Applied Biosystems ABI7300 PCR and ViiA7 detection systems and software. All Ct values were manually checked. cDNAs were diluted when necessary to avoid Cts lower than 18. Taqman Assays: Gsc (Mm00650681_g1), Nes (Mm00450205_m1), Pouf51 (Mm00658129_gH), Mixl1 (Mm00489085_m1), Nanog (Mm02019550_s1) Trim33 (Mm01308695_m1); all from Thermo-Fisher Scientific. Actb: Forward Primer (tgacaggatgcagaaggaga), Reverse Primer (cgctcaggaggagcaatg), Universal Probe #106 (Roche).

Rajderkar S., Panaretos C, & Kaartinen V. (2017). Trim33 regulates early maturation of mouse embryoid bodies in vitro. Biochemistry and Biophysics Reports, 12, 185-192.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Mouse Palatal RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tissues were harvested from tips of palatal shelves from E14 and E15 mouse embryos, placed into 200µl of RLT (RNeasy mini kit, Qiagen), and RNAs were isolated by using RNeasy columns (Qiagen). cDNAs were synthesized by using Omniscript reverse transcriptase (Qiagen) according to the manufacturer’s protocols. Real time quantitative PCR experiments were done either by using Universal Probe library-based assays (Roche Applied Science) or by using TaqMan assay reagents (Applied Biosystems) (see Table II). 30µl assays were quantified using Applied Biosystems ABI7300 PCR and ViiA7 detection systems and software. Data were normalized to β-actin mRNA levels using the 2^−ΔΔCt method.

Lane J., Yumoto K., Azhar M., Ninomiya-Tsuji J., Inagaki M., Hu Y., Deng C.X., Kim J., Mishina Y, & Kaartinen V. (2014). Tak1, Smad4 and Trim33 redundantly mediate TGF-β3 signaling during palate development. Developmental biology, 398(2), 231-241.

+ Open protocol

+ Expand

Quantitative RT-PCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Most experiments were carried out using Universal Probe Library-based assays (Roche Applied Science) with gene-specific primer sequences generated by the manufacturer’s online algorithm and TaqMan Universal PCR master mix (Applied Biosystems) (see Supplemental Table 3 for sequences). Some used Taqman Assay reagents (see Supplemental Table 3). 30µl assays were quantified using Applied Biosystems ABI7300 PCR and ViiA7 detection systems and software. All Ct values were checked by eye. Actb levels were used to normalize other expression levels. cDNA was diluted to avoid Cts lower than 18. At least three separate control (Cre negative or conditional heterozygote) and three separate mutant samples were assessed for each genotype/condition, where possible from the same litter, or at least stage-matched.

Thomas P.S., Rajderkar S., Lane J., Mishina Y, & Kaartinen V. (2014). AcvR1-mediated BMP signaling in second heart field is required for arterial pole development: Implications for myocardial differentiation and regional identity. Developmental biology, 390(2), 191-207.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!