Genemorph 2 ezclone domain mutagenesis kit

Error-prone PCR mediated mutagenesis of 249 bp spanning the B4 RNase III-like domain was performed using the GeneMorph II EZClone Domain Mutagenesis kit (Agilent Technologies). The template plasmid was the Gateway entry clone pDONR221-B4 which contains the wild-type (WT) B4 open reading frame (ORF) without the stop codon. Briefly, 100 ng of the target domain DNA (15.2 μg template plasmid) was mutagenized by 30 cycles of PCR according to the manufacturer’s protocol using the following primers: 5’-TTCCTGGGCGAAAGCTTT-3’ and 5’-GAGAACATTTGCAACTCCCC-3’ (Supplementary Table 1). The PCR products were separated by gel electrophoresis and purified using a gel-extraction kit (Qiagen). The purified mutagenized PCR products were then used as megaprimers for amplification (25 cycles) of pENTR-Express-B4 plasmid which contains the WT B4 ORF without the stop codon flanked by attL sites, and in frame with the neomycin phosphotransferase sequence that confers resistance to kanamycin (Gray et al., 2007 (link)).

We constructed recombinant plasmid pECtLac in our previous study, which was used as a template for random mutagenesis in the current study (Ghatge et al. 2018 (link)). Error-prone polymerase chain reaction (PCR) was performed to introduce random mutations into CtLac within the pECtLac plasmid at low mutation frequency using the GeneMorph II EZClone domain mutagenesis kit (Agilent Technology) according to the manufacturer’s protocol. The following primers were used for PCR: Lac-F 5′ACGTACATATGAAACGGATTTTAACACTAGTTCTTC3′ and Lac-R 5′GATACCTCGAGTTATTCAGGTTTGTTCGGGATG3′. The restriction sites of NdeI and XhoI are underlined and the stop codon is indicated in bold letters. The PCR conditions were followed by segment 1 (95 °C for 2 min), 30 cycles of segment 2 (95 °C for 30 s, 53 °C for 30 s, and 72 °C for 1 min 30 s), and segment 3 (72 °C for 10 min). The resulting PCR products were used as megaprimers in EZClone reaction for the ligation with pET28a( +). E. coli strain XL10-Gold was transformed by the resulting plasmids. The plasmid library was prepared from the obtained transformants and retransformed into expression host E. coli strain BL21(DE3) followed by protein induction and laccase activity screening using 2,6-DMP as a substrate.