Scrambled si-RNA (sc-29470) was purchased from Santa Cruz Biotechnology. APE1 si-RNA (L-010237–00-0005) was obtained from Dharmacon (Lafayette, CO, USA). The flag-tagged coding sequence of APE1 was cloned in pcDNA3.1 mammalian expression plasmid (Invitrogen, Carlsbad, CA, USA). APE1 redox-deficient mutant (C65A) was developed by QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA). The flag-tagged coding sequence of YAP1 was cloned in pcDNA3.1 mammalian expression plasmid (Invitrogen, Carlsbad, CA, USA). The mammalian expression HA-Ubiquitin plasmid was purchased from Addegene (Addgene plasmid # 18,712; http://n2t.net/addgene:18712 ; RRID: Addgene18712) [25 (link)]. For transient overexpression of APE1 or YAP1, mammalian expression plasmids or empty vector were transfected into OE33 and FLO-1 cells using PolyJet reagent (SignaGen Laboratories, Rockville, MD, USA). For transient knockdown of APE1, si-APE1 or scrambled si-RNA were transfected into OE33 and FLO-1 cells using LipoJet reagent (SignaGen Laboratories, Rockville, MD, USA). Cells were harvested within 72 h of transient transfection.
Pcdna3.1 mammalian expression plasmid
Manufactured by Thermo Fisher Scientific
Sourced in United States
The pcDNA3.1 mammalian expression plasmid is a vector designed for the expression of recombinant proteins in mammalian cell lines. It contains a strong viral promoter, selection markers, and a multiple cloning site for the insertion of the gene of interest.
Automatically generated - may contain errors
Lab products found in correlation
Calcium phosphate transfection kit, by Applied Biological Materials (3 mentions)
Control sirna sc 29470, by Santa Cruz Biotechnology (2 mentions)
Ape1 sirna sc 29470, by Santa Cruz Biotechnology (2 mentions)
Srp20 sirna sc 38338, by Santa Cruz Biotechnology (2 mentions)
Darpp 32 sirna sc 35173, by Santa Cruz Biotechnology (2 mentions)
Scrambled sirna, by Santa Cruz Biotechnology (1 mentions)
Quickchange lightning site directed mutagenesis kit, by Agilent Technologies (1 mentions)
Polyjet reagent, by SignaGen (1 mentions)
Lipojet reagent, by SignaGen (1 mentions)
La taq pcr kit, by Takara Bio (1 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (1 mentions)
293ltv cells, by Cell Biolabs (1 mentions)
Hiprep 26 10 column, by GE Healthcare (1 mentions)
Histrap excel column, by GE Healthcare (1 mentions)
11 protocols using pcdna3.1 mammalian expression plasmid
1
Overexpression and Knockdown of APE1 and YAP1
2
Adenoviral and Lentiviral APE1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The FLAG-tagged coding sequence of APE1 was cloned into pcDNA3.1 mammalian expression plasmid (Invitrogen, Carlsbad, CA USA). The APE1 coding sequence from pcDNA3.1/APE1 plasmid was sub-cloned using Xba I and BamH I restriction sites in the adenoviral shuttle vector pACCMV. The recombinant adenovirus expressing APE1 was generated by co-transfecting HEK-293 cells with the shuttle and backbone adenoviral pJM17 plasmids using a Calcium Phosphate Transfection kit (Applied Biological Materials Inc., Richmond, BC) (34 (link)). Lentivirus particles expressing APE1 shRNA or control shRNA were produced by VectorBuilder Inc. (Santa Clara, CA, USA) and then used to transduce OE33 and CPB cells. Control siRNA (sc-29470) and APE1 siRNA (sc-29470) were obtained from Santa Cruz Biotechnology.
3
Molecular Cloning and Knockdown Approaches
4
Cloning and Characterization of NQO1 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A 2.4 kb of human NQO1 promoter was obtained from the genomic DNA of BEAS-2B cells by the LA Taq PCR Kit (Takara) using primer pair GGCTTCTCAGACCACTCCTG and ACTAGGCTCTCGGTGAGCTG and subcloned into the pGL4.13 luciferase expression plasmid (Promega) between the SacI and XhoI sites. A-1221C mutation (rs689455) at the NQO1 promoter region of the pGL4-NQO1 plasmid was introduced by site-directed mutagenesis PCR using primer pair AGGTCGGGAGTTGGAAAC and CAGGTGATCCTACCGCCT. These two plasmids were named pGL4-NQO1 and pGL4-SNPNQO1.
To obtain the NQO1 expression plasmid pCD-NQO1, total RNA was extracted from BEAS-2B cells and subjected to reverse transcription using the SuperScript III First-Strand Synthesis System (Invitrogen). The open reading frame and the 3′-UTR of human NQO1 were obtained as one piece by the subsequent PCR (Takara) using primer pair CAGCTCACCGAGAGCCTAGT and AAAAACCACCAGTGCCAGTC and then subcloned between the NheI and XhoI sites of the pcDNA3.1(+) mammalian expression plasmid (Invitrogen). It was named pCMV-NQO1. The CMV promoter in pCD-NQO1 was replaced by the 2.4 kb wild-type or SNP-human NQO1 promoter, which was excised from pGL4-NQO1 and pGL4-SNPNQO1. The two new plasmids were named pNQO1-NQO1 and pSNPNQO1 (or pSNP). The correct sequence of each plasmid was verified by DNA sequencing.
To obtain the NQO1 expression plasmid pCD-NQO1, total RNA was extracted from BEAS-2B cells and subjected to reverse transcription using the SuperScript III First-Strand Synthesis System (Invitrogen). The open reading frame and the 3′-UTR of human NQO1 were obtained as one piece by the subsequent PCR (Takara) using primer pair CAGCTCACCGAGAGCCTAGT and AAAAACCACCAGTGCCAGTC and then subcloned between the NheI and XhoI sites of the pcDNA3.1(+) mammalian expression plasmid (Invitrogen). It was named pCMV-NQO1. The CMV promoter in pCD-NQO1 was replaced by the 2.4 kb wild-type or SNP-human NQO1 promoter, which was excised from pGL4-NQO1 and pGL4-SNPNQO1. The two new plasmids were named pNQO1-NQO1 and pSNPNQO1 (or pSNP). The correct sequence of each plasmid was verified by DNA sequencing.
5
Engineered snoMEN Expression Vectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sequence spanning exon 2 to exon 3 of the C19orf48 gene and the sequence spanning exon 5 to exon 6 of the TBRG4 (transforming growth factor beta regulator 4) gene were inserted 3’ of the CMV promoter in the pcDNA3.1 mammalian expression plasmid (Invitrogen), creating U47/U77 box C/D type snoMEN and ACA16/miR-566 box H/ACA type snoMEN expression vectors. SnoMEN and mutant snoMEN derivatives of each snoRNA were established from the respective wild type snoRNA expression mini gene constructs by site directed mutagenesis. The plasmids were transfected into either HeLa, or U2OS cells, using “effectine” transfection regent (QIAGEN).
6
DARPP-32 Expression in Cell Lines
7
Cloning and Silencing of DARPP-32
8
Adenoviral and Lentiviral APE1 Expression
9
Molecular Cloning and Knockdown Approaches
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The flag-tagged coding sequence of DARPP-32, SRp20 and CD44E were cloned in pcDNA3.1 mammalian expression plasmid (Invitrogen). AGS cells stably expressing DARPP-32 or pcDNA3.1 empty vector were generated as described previously (Belkhiri et al 2005 (link), El-Rifai et al 2002 (link)). Lentivirus particles expressing DARPP-32 shRNA or control shRNA were produced by GeneCopoeia (Rockville, MD) and then utilized to transduce MKN-45 cells. SRp20 siRNA (sc-38338) was obtained from Santa Cruz Biotechnology (Santa Cruz, CA).
10
Lentiviral Knockdown and Overexpression of APE1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
APE1 shRNA and control shRNA lentiviral plasmids were obtained from Vector Builder Inc. (Santa Clara, CA, USA). Plasmids were co-transfected with second generation packaging mix (Abm) into 293LTV cells (CellBiolabs, San Diego, CA), following the manufacturer's protocol. After 72 h transfection, the media supernatants were collected and stored at −80 °C. CPB, FLO1 and OE33 cells were infected with control or APE1shRNA media supernatants in the presence of polybrene (4 μg/mL) for 72 h. Stable cell lines expressing control or APE1shRNA were selected using puromycin and used for further experiment. The FLAG-tagged coding sequence of APE1 and its mutant C65A were cloned into pcDNA3.1 mammalian expression plasmid (Invitrogen, Carlsbad, CA USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!