Hyperscript kit

Manufactured by GeneAll

The HyperScript™ kit is a laboratory equipment product designed for the amplification of DNA or RNA sequences. It contains the necessary reagents and components required for the reverse transcription and subsequent polymerase chain reaction (PCR) processes.

Automatically generated - may contain errors

Lab products found in correlation

Nanodrop, by Thermo Fisher Scientific (4 mentions) Realq plus 2x master mix, by Ampliqon (2 mentions) Hybrid rtm blood rna purification kit, by GeneAll (1 mentions) Rotor gene rg 300, by Qiagen (1 mentions) Hybrid r kit, by GeneAll (1 mentions) Realamp sybr qpcr master mix, by GeneAll (1 mentions) Nanodrop 8000 spectrophotometer, by Thermo Fisher Scientific (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Hybrid r blood rna purification kit, by GeneAll (1 mentions) Step oneplus real time pcr, by Ampliqon (1 mentions)

5 protocols using hyperscript kit

Quantification of TTP, miR-16-5p, and HPRT1 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

According to the manufacturer’s protocol, total RNA was extracted from whole blood using the Hybrid-RTM blood RNA purification kit (GeneALL, Seoul, South Korea). Nanodrop was used to evaluate the concentration and quality of extracted RNA (Thermo Scientific, Wilmington, DE). Following the manufacturer’s instructions, cDNA was synthesized using the HyperScript™ kit (GeneAll). The cDNA was prepared and stored at -20 °C for later use. Table 1 lists the primers used to amplify TTP, the housekeeping gene, Hypoxanthine Phosphoribosyltransferase 1 (HPRT1), and unique stem-loop primers for has-miR-16-5p and U6 snRNA as reference RNA. The Step OnePlus™ Real-Time PCR and the RealQ Plus2x Master Mix were used to perform the qPCR (Ampliqon, Odense, Denmark).

Table 1

Primers used for the
expression assay

List of primers used in this study
Gene name	Gene reference ID	Primer sequences (5’-3’)
TTP	NM_003407.5	Forward primerGACATTCAGAGAAGGGCATCAG Reverse primerAGGCTGCTCAGTAATCCTCTC
HPRT1	NM_000194.3	Forward primerAGCCTAAGATGAGAGTTC Reverse primerCACAGAACTAGAACATTGATA
miR-16-5P	-	Forward primerAACAGTGTAGCAGCACGTAAA Reverse primerGTCGTATCCAGTGCAGGGT SLP primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGCCAA
U6	-	Forward primerGCTTCGGGCAGCACATATCTAAAAT Reverse primerAAAGCCCGAAGCTGTGATGATGC SLP primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAAATAT

*SLP Stem-loop primer

Asadi M.R., Gharesouran J., Sabaie H., Moslehian M.S., Dehghani H., Arsang-Jang S., Taheri M., Mortazavi D., Hussen B.M., Sayad A, & Rezazadeh M. (2022). Assessing the expression of two post-transcriptional BDNF regulators, TTP and miR-16 in the peripheral blood of patients with Schizophrenia. BMC Psychiatry, 22, 771.

+ Open protocol

+ Expand

Quantifying Gene Expression via RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cells using the Hybrid-R™ kit (GeneAll), according to the supplier’s instructions. To synthesize cDNA, 0.5 μM total RNA was primed with oligo dT and reverse transcribed using a cDNA synthesis HyperScript™ kit (GeneAll). cDNA was amplified using the RealAmp SYBR qPCR Master mix (GeneAll) containing specific primer pairs (Macrogen, Seoul, Korea). The reaction was performed at 95 °C for 10 min, followed by 40 cycles of amplification (95 °C for 10 s, 58 °C for 15 s, and 72 °C for 20 s). mRNA levels of specific genes were normalized to those of of Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH). The primer sequences of specific genes are described in Table S1. Amplification was measured using a Rotor-Gene RG-300 (Corbett, Hilden, Germany) instrument.

Park C., Park J., Kim W.J., Kim W., Cheong H, & Kim S.J. (2021). Malonic Acid Isolated from Pinus densiflora Inhibits UVB-Induced Oxidative Stress and Inflammation in HaCaT Keratinocytes. Polymers, 13(5), 816.

+ Open protocol

+ Expand

RNA Extraction and cDNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The RNeasy Mini Kit (Qiagen, Hilden, Germany) was used to extract the total RNA. The RNA purity, quality and quantity were checked using a Nanodrop 8000 spectrophotometer (Thermo Fisher Scientific, USA). The Hyperscript Kit (GeneAll, Seoul, Korea) and random hexamers (GeneAll, Seoul, Korea ) were used to reverse-transcript 1 µg of RNA from each sample into cDNA as described in the manufacturer’s protocol.

El-Sayed N.N., Al-Otaibi T.M., Barakat A., Almarhoon Z.M., Hassan M.Z., Al-Zaben M.I., Krayem N., Masand V.H, & Ben Bacha A. (2023). Synthesis and Biological Evaluation of Some New 3-Aryl-2-thioxo-2,3-dihydroquinazolin-4(1H)-ones and 3-Aryl-2-(benzylthio)quinazolin-4(3H)-ones as Antioxidants; COX-2, LDHA, α-Glucosidase and α-Amylase Inhibitors; and Anti-Colon Carcinoma and Apoptosis-Inducing Agents. Pharmaceuticals, 16(10), 1392.

+ Open protocol

+ Expand

Whole Blood RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA extraction was achieved from whole blood using a Hybrid-R™ Blood RNA purification kit (GeneALL, Seoul, South Korea) according to the manufacturer's protocol. The extracted RNA's concentration and quality were assessed with Nanodrop (Thermo Scientific, Wilmington, DE). cDNA was synthesized using the HyperScript™ kit (GeneAll) according to the manufacturer's instructions. Prepared cDNA was stored at -20 °C for further use. The primers were designed by Oligo7 software. The used primers for ERMN, LTN1, and ubiquitin C (UBC) as the housekeeping gene are shown in Table 1. UBC was chosen because it has been introduced as one of the most stable housekeeping genes in schizophrenia studies (Weickert et al. 2010; Silberberg et al. 2009 ). The qPCR was carried out by the Step OnePlus™ Real-Time PCR and the RealQ Plus2x Master Mix (Ampliqon, Odense, Denmark).

Farhang S., Sabaie H., Gharesouran J., Asadi M.R., Arsang-Jang S., Ghafouri-Fard S., Taheri M, & Rezazadeh M. (2022). Expression Analysis of Ermin and Listerin E3 Ubiquitin Protein Ligase 1 Genes in the Periphery of Patients with Schizophrenia. Journal of molecular neuroscience : MN, 72(2).

+ Open protocol

+ Expand

One-Step RT-PCR for HERV-Kenv Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

One-step RT-PCR method was used for RT-PCR. In this method, cDNA production and PCR reaction are performed simultaneously in one step. For this purpose, a ready-made HyperScript kit (Gene All, South Korea) was used. In order to perform the reaction, the 96well thermocycler (BIO-RAD, USA) was used. 1μl (10Pmol) of primer, 2μl of extracted RNA sample, and 7μl of RNase-free water were added to 10μl of Mastermix. The reaction temperature program was performed at 55°C for 60 minutes, the primary denaturation stage was at 94°C for 5 minutes, 35 cycles with a temperature program of 94°C for 30 seconds (secondary denaturation), 59°C for 30 seconds (for primers annealing), 72°C for 45 seconds (extension) and finally 8 minutes at 72°C for a final extension.
PCR test was optimized as a positive control using Hela cancer cell line (cervical adenocarcinoma), which expresses the HERV-Kenv gene. After electrophoresis of PCR product, the specific band obtained from HERV-Kenv primers (168 bp) and β-actin primers (94 bp) were examined. To ensure the PCR test's optimization and get a specific sample band and positive internal control, the optimized PCR test was used for 50 patient samples and 50 control samples. Finally, the accuracy of the RT-PCR reaction was evaluated by 2% agarose gel.

Tourang M., Fang L., Zhong Y., & Suthar R. (2021). Association between Human Endogenous Retrovirus K gene expression and breast cancer. Cellular Molecular and Biomedical Reports, 1(1), 7-13.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!