Pgph1 neo

The full-length PVT1 (NR_003367) transcript was PCR amplified from cDNA derived from A375 cell with the Ex Taq® Hot Start Version DNA Polymerase (Takara) and subcloned into the Kpn I and BamH I sites of pcDNA3.1(+) plasmid (Invitrogen). The primers sequences are as follows: 5′-GGGGTACCCTCCGGGCAGAGCGCGTGTG-3′ (forward) and 5′-CGGGATCCTAGACACGAGGCCGGCCACGC-3′ (reverse). To inhibit PVT1 expression, two oligonucleotides for shRNAs were synthesized and inserted into the shRNA expression vector pGPH1/Neo (GenePharma, Shanghai, China). The shRNAs sequences are as follows: shRNA #1, 5′-GCTTCAACCCATTACGATTTC-3′; shRNA #2, 5′-GGACTTGAGAACTGTCCTTAC-3′. A scrambled shRNA was used as negative control. Vectors were transfected into melanoma cells using Lipofectamine 3000 (Invitrogen) following the manufacturer's manual.

CRC cell lines (LoVo, SW620, HCT116 and SW480) and normal cells HIEC were obtained from Cobioer (Nanjing, China) and followed their instructions to culture at 37°C. Sh-LncRNA DLEU1(sequence: CAACGGAAUGUAUCAAUGATT), sh-PRPS1(sequence: GCAGCTCCCACCAGGACTTAT), sh-NC(sequence: TTCTCCGAACGTGTCACGT), miR-320b mimics(sequence: AAAAGCUGGGUUGAGAGGGCAA), NC mimics(sequence: UUCUCCGAACGUGUCACGUTT), miR-320b inhibitors(sequence: UUGCCCUCUCAACCCAGCUUUU) and NC inhibitors(sequence: CAGUACUUUUGUGUAGUACAA) were obtained from RIBOBIO (Guangzhou, China). Cell transfection was conducted following the instruction of Lipofectamine 2000 (Invitrogen, CA, USA). Stably DLEU1-knockdown cell lines were screened out as previously reported (20 (link)). In brief, oligonucleotide for small hairpin RNA (shRNA) targeting DLEU1 was synthesized and inserted into the shRNA vector pGPH1/Neo (GenePharma, Shanghai, China). The DLEU1 shRNA vector was transfected into LoVo and SW480 cells with Lipofectamine 3000 (Invitrogen, CA, USA) and selected for 4 weeks with neomycin (1000 μg/ml). Scrambled shRNA (sh-NC) was applied as control. After culturing for 48 h, cells were utilized for follow-up study.

DANCR expressing plasmid pcDNA3.1-DANCR was constructed as previously described [40 (link)]. Briefly, DANCR full-length sequence was PCR amplified using the PrimeSTAR HS DNA polymerase (Takara) and the primers 5′-CCCAAGCTTGCCCTTGCCCAGAGTCTTC-3′ (sense) and 5′-CGGGATCCGTCAGGCCAAGTAAGTTTATTAAC-3′ (antisense). Next, the PCR products were subcloned into the Hind III and BamH I sites of pcDNA3.1. DANCR knockdown plasmid was constructed as previously described [38 (link)]. Briefly, one pair of cDNA oligonucleotides specifically targeting DANCR was inserted into the shRNA expression plasmid pGPH1/Neo (GenePharma, Shanghai, China). The sequences of DANCR specific shRNA were: 5′-CACCAGCCAACTATCCCTTCAGTTACATTCAAGAGATGTAACTGAAGGGATAGTTGGCTTTTTTTG-3′ (sense) and 5′-GATCCAAAAAAAGCCAACTATCCCTTCAGTTACATCTCTTGAATGTAACTGAAGGGATAGTTGGCT-3′ (antisense). The sequences of control scrambled shRNA were: 5′-CACCGTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTTG-3′ (sense) and 5′-GATCCAAAAAATTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAAC-3′ (antisense). Plasmids transfection was carried out using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s protocols.