Sybr green intercalating fluorophore system

Chromatin immunoprecipitation (CHIP) was performed with CHIP assay kit (Beyotime, P2078) according to the manufacturer's description. In brief, SU-DHL4 cells were harvested followed by cross-linking with 1% (v/v) formaldehyde for 10 min and resuspended in SDS lysis buffer. Cells were lysed and DNAs were fragmented by sonication. The chromatins were immunoprecipitated with anti-FOXO1 overnight at 4 °C. After washing and elution, crosslinks were reversed for 4 h at 65 °C. The eluted DNA was purified and analyzed by qPCR using a Bio-Rad SYBR Green intercalating fluorophore system with BCL-2 primers forward: GTGTAGTGCGCGGACACCTAGG and primers reverse: GCTGCCCTGCTGTGAAGACAGG.

Total RNAs were isolated from minor salivary glands (MSGs) biopsy tissues, PBMCs or differentiated Th17 cells using TRIzol reagent (Life Invitrogen, Carlsbad, CA, USA). cDNAs were reverse transcribed from 0.1 µg total mRNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA). For sample analysis, the threshold was set based on the exponential phase of amplifications, and CT value for samples was determined. The resulting data were analyzed with the comparative CT method for relative gene expression quantification against house keeping gene GAPDH. qPCR was performed using the Bio-Rad SYBR Green intercalating fluorophore system. Primers were listed in the Table S1 in Supplementary Material.

Human naïve CD4⁺ T cells were differentiated under Th17 differentiation conditions for 8 days, followed by cross-linking for 8 min with 1% (vol/vol) formaldehyde. Cells were collected and lysed by sonication. Cell lysates were immunoprecipitated with anti-H3K4me3 (ab8580, Abcam), anti-STAT5 antibody (#9363, Cell Signaling), and anti-STAT3 antibody (clone c-20, Santa Cruz). After washing and elution, crosslinks were reversed for 4 h at 65°C. The eluted DNA was purified, and analyzed by qPCR with custom-designed primers, Forward: TAGCACCAACAGCACTTCTAGC Reverse: TCAGCACATGCATCATTGTCAG using a Bio-Rad SYBR Green intercalating fluorophore system. The Ct value for each sample was normalized to corresponding input value.