Tb green premix ex taq 2 tli rnase h plus

Using the Direct-zol RNA Miniprep (ZymoResearch) including a DNase digestion step, total RNA was isolated from HUVEC cell cultures according to the protocol of the manufacturer. One (1) μg total RNA of each sample was reverse-transcribed into complementary DNA (cDNA) by using the MuLV reverse transcriptase kit (Invitrogen) following the manufacturer's protocol. Quantitative real-time polymerase chain reaction (qRT-PCR) using SYBR Green [TB Green® Premix Ex Taq™ II (Tli RNase H Plus)] was performed on the 384-well PCR Thermal Cycler StepOnePlus or QuantStudio™ 7 (Applied Biosystems) system. Expression of each gene was normalized to RPLP0 (housekeeping gene; for details of primers used for qRT-PCR see Supplementary Table 3). Relative expression levels were determined through the formula 2^−ΔCt (ΔC_t = C_t(gene) – C_{t(housekeeping gene)}).

The qRT-PCR was performed as we previously described [35 ]. Total RNAs in the hippocampus were extracted using the RNAeasy™ animal RNA isolation kit with a spin column according to the manufacturer's protocol. Isolated RNAs were reverse-transcribed into cDNA using the PrimeScript™ RT Master Mix (Perfect Real Time) following the standard protocol. The qPCR assay was conducted using TB Green™ Premix Ex Taq™ II (Tli RNaseH Plus) with the Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems, CA, USA). The amplification parameters were 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 34 s, 95 °C for 15 s, 60 °C for 60 s, and 95 °C for 15 s. The gene expression levels were calculated using the 2^−ΔΔCt method. Each sample was analyzed in triplicate, and the relative expression of mRNA was calculated after normalization to β-actin. The relative mRNA expression level in the WT group (target mRNA/β-actin value) was set to 100%, and the mRNA values in other groups were converted to fold changes after comparison with the control group.
The following PCR primer sequences were used for detecting transcriptions: β-actin, F: 5′‐GTGACGTTGACATCCGTAAAGA‐3′, R: 5′‐GTAACAGTCCGCCTAGAAGCAC‐3’; ChemR23, F: 5′‐TACGACGCTTACAACGACTCC‐3′, R: 5′‐TAGGAGACCGAGGAAGCACA‐3’.

Expression analysis of selected genes was performed with three biological replicates for control and BER-fed larvae by qRT-PCR. Total RNA from the insect tissue was extracted by using TRIzol reagent (Invitrogen, USA) according to the manufacturer's instructions. DNase I (Sigma-Aldrich)-treated RNA was reverse transcribed using a high-capacity cDNA reverse transcription kit (Applied Biosystems). Gene-specific oligonucleotides were designed using Primer-BLAST software (NCBI). The qRT-PCR analysis using Takara TB Green Premix Ex Taq II (Tli RNase H Plus) was performed on 7500 Fast Real-Time PCR System (Applied Biosystems, Foster, CA, USA). The oligonucleotides used are listed in the Table S2. PCR reactions were performed as three independent replicates. Relative expression levels were estimated by calculating the 2^−ΔΔCt for each gene. The S. frugiperda elongation factor 1-alpha (SfEf1-alpha) was used as the internal control for mRNA abundance calculation.