Pcmv sport6 mical l2 plasmid

The pEGFP‐N1 vectors containing full‐length Cdc42‐Q61L (CA) or Cdc42‐T17N (DN) insert were both saved in this laboratory. Human full‐length MICAL‐L2 cDNA was amplified from pCMV‐SPORT6‐MICAL‐L2 plasmid (YouBio, Hunan, China) using the following primer set, sense: 5′‐CTACCGGACTCAGATCTCGAGCCACCATGGCGGCCATCAGGGC‐3′ and antisense: 5′‐GTACCGTCGACTGCAGAATTCGCTGGGAGGGGCTGCTTTT‐3′. In these primers, XhoI and EcoRI restriction site sequences have been underlined. The PCR products were cloned into the pEGFP‐N1 vector (Clontech, Palo Alto, CA). All constructions were ensured by sequencing. Transfection steps were following the manufacturer's protocols, using Lipofectamine 2000 (Invitrogen, Carlsbad, CA).
The siRNAs were synthesized and purified by China GenePharma Co., and the siRNAs specifically targeting MICAL‐L2 were as follows: #1, 5'‐GGUUCCCACAAAGAGUAUATT‐3′; #2, 5'‐CUCGACGUUUGUGACAACUTT−3′; #3, 5'‐CCAAGUUCCGCUUGUCCAATT‐3′. The transfection of MICAL‐L2 siRNA or control siRNA with Lipofectamine 2000 was performed according to the manufacturer's instruction.
After transfected with plasmid or siRNA for 24 hours, the cells were cultured in starvation medium overnight and then treated with EGF (R&D Systems, Minneapolis, MN), CHX (Sigma, Saint Louis, MO), Erlotinib (APEXBIO, Houston, TX) at the indicated time points.

Full-length MICALL2 was PCR-amplified from the pCMV-SPORT6-MICAL-L2 plasmid (YouBio, Hunan, China) and cloned into the pCMV-C-HA or pEGFP-N1 vector (Beyotime, Nantong, China) as previously described (Min et al., 2019 (link)). For plasmid construction, the cDNA of the c-Myc gene was amplified by PCR from NCI-H1299 cells and inserted into the pCMV-N-Flag vector (Beyotime). All the constructs were verified by sequencing. When the cells had reached ~80% confluence, they were transfected with the relevant plasmids using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions.
siRNAs targeting MICAL-L2 were purchased from China GenePharma Co., and contained the following sequences: siMICAL-L2 #1, 5′-GGUUCCCACAAAGAGUAUATT-3′; siMICAL-L2 #2, 5′-CUCGACGUUUGUGACAACUTT-3′; siMICAL-L2 #3, 5′-CCAAGUUCCGCUUGUCCAATT-3′. The cells were transfected with MICAL-L2 siRNA or control siRNA using Lipofectamine 2000 at 80% confluence.
The transfected cells were treated with cycloheximide (CHX) (Sigma-Aldrich, Saint Louis, MO, USA), MG-132 (Selleck Chemicals, Houston, TX. USA), Velcade (Selleck Chemicals), acadesine (AICAR; Selleck Chemicals), or chloroquine diphosphate (Chlq; MedChemExpress, Monmouth, Junction, NJ, USA) at the indicated time points.