According to the manufacturer’s instructions, the total RNA was isolated from A549 and H1299 cells using a TRIpure reagent kit (Aidlab Biotechnologies, Beijing, China). The RNA (500 μg) was reversibly transcribed with 4 μl 4× gDNA wiper Mix, 1 μl Oligo (dT) 18 (10 μM) primer, and 4 μl 5×HiScript® II Select qRTSuperMix II (Vazyme Biotech, Nanjing, China). Then we used the 2×AceQ qPCR SYBR Green Master Mix (Vazyme Biotech, Nanjing, China) and specific primers to perform PCR amplification. The following forward and reverse primers (5′-3′) were used: GAPDH forward, AGA TCC CTC CAA AAT CAA GTG G; and GAPDH reverse, GGC AGA GAT GAT GAC CCT TTT; MRP1 forward, TCT CAA CAA AAC CAA AAC TGC CT; and MRP1 reverse, CTG AAC TCC CTT CCT CCT CTC C. Observing the specificity of the melting curve after the reaction and calculating the 2−ΔΔCt according to the formula. The experiment was repeated three times.
Tripure reagent kit
Manufactured by Aidlab
Sourced in China
The TRIpure reagent kit is a product designed for the isolation and purification of total RNA from various biological samples. It utilizes a monophasic solution of phenol and guanidine isothiocyanate to effectively lyse cells and denature cellular components, allowing for the extraction and separation of RNA. The kit provides a reliable and efficient method for obtaining high-quality RNA suitable for downstream applications such as RT-PCR, Northern blotting, and other RNA-based analyses.
Automatically generated - may contain errors
Lab products found in correlation
Hiscript 2 select qrt supermix 2, by Vazyme (1 mentions)
Aceq qpcr sybr green master mix, by Vazyme (1 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (1 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Nanodrop, by Thermo Fisher Scientific (1 mentions)
3 protocols using tripure reagent kit
1
Quantitative RT-PCR Analysis of GAPDH and MRP1
2
Quantitative Real-Time PCR Analysis of Rice Seedling Roots
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to the qRT-PCR method [3 ], mRNA of two-week treatment rice seedling roots was extracted by using the TRI pure reagent kit (Aid Lab). Primers used in these assays synthesized by Qingke Company (QingkeZixi Co., Ltd., Chengdu, China) are listed in Table 2 , and the expression levels were normalized to those of the Actin1 and EF1α as indicated. qRT–PCR was carried out on a CFX96 Real-Time PCR Detection System (Bio-Rad) with SYBR Green Master Mix (2X) to monitor double-stranded DNA synthesis using a three-step PCR cycling program (95 °C for 15 s, followed by 40 cycles of 95 °C for 15 s, 55 °C for 15 s and 72 °C for 20 s). The 2−ΔΔCT method was used to calculate the expression levels of target genes [49 (link), 50 (link)].
Oligo sequences used in this study
| Gene | Primer sequences |
|---|---|
| Actin1 (Os03g0718100) | FW: TCCATCTTGGCATCTCTCAG RV: GTACCCGCATCAGGCATCTG |
| EF1α(Os03g08010) | FW: TTTCACTCTTGGTGTGAAGCAGAT RV: GACTTCCTTCACGATTTCATCGTAA |
| OsPT2(Os03g05640) | FW: AAACTTCCTCGGTATGCTCATG RV: ATGTTTATGACATCACGCTTGG |
| OsNIP2;1(Os02g51110) | FW: AACATCCAAGTGTGATAGGACG RV: ACACAAAGACGTAGCTAGTGAT |
| OsSultr1;2(Os03g0195500) | FW: TCAAAGAAGAACCCGCTAGATT RV: GCAATTCCAAGGAAGCCTTTAA |
| CAL1(Os02g0629800) | FW: AGTCGCGTGTTCTCCTTTGT RV: AGTCGCGTGTTCTCCTTTGT |
3
RNA extraction, cDNA synthesis, RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of parents were extracted from fresh leaves using the TRIpure Reagent kit (Aidlab, Wuhan, China). RNA quality was check by electrophoresis on 2 % agarose gel, purity and concentration were measured with Nanodrop (Thermo Scienti c, USA). 2 mg RNA was reverse transcribed into cDNA using the RevertAid First strand cDNA synthesis kit (Thermo Scienti c, USA). RT-PCR was performed with the cDNA to measure the relative expression level of Rs390250 in WA and J4. Gene-speci c primers were obtained from a qPCR primer database at https://biodb.swu.edu.cn/qprimerdb/ (Lu et al. 2018 (link)). Actin was used as the reference gene to control the amount of input RNA.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!