Lightcycler 480 2 system

RT-qPCR was performed using SYBR Green qPCR Mix (TaKaRa, Dalian, China) and RocheLight Cycler^® 480 II system (Roche Applied Science, Mannheim, Germany) according to the manufacturer’s protocol. RT-qPCR was performed in a volume of 20 µL containing approximately 0.8 µL of 10 µmol/L of each primer, 10 µL of SYBR Green qPCR Mix, 2.0 µL of 50 ng/µL of genomic DNA, and the rest in ddH₂O. RT-qPCR conditions were as follows: denaturation at 95 °C for 5 min, followed by a period of 5 min in the Roche LightCycler^®480 II system (Roche Applied Science, Mannheim, Germany) for 40 cycles, denaturing at 95 °C for 5 s and annealing at 60 °C for 30 s. The goat RPR19 was used as a reference gene. The information of RT-qPCR primer sequences is shown in Table 4. The primers were synthesized at Shanghai Biotechnology Co., Ltd.

Amplification was performed in a 10-µl reaction with 5 µl 2× EvaGreen mix (MasterMix-S; Applied Biological Materials, Richmond, Canada), 0.8 µl each primer (10 nmol/litre), 2 µl sample complementary DNA, and 2.2 µl ddH2O. Real-time PCR was performed using a Roche Light Cycler 480II System (Roche Diagnostics, Mannheim, Germany). The PCR program was initiated at 95 °C for 10 min, followed by 40 cycles of denaturation for 5 s at 95°, annealing for 30 s at 60°, and elongation for 60 s at 72°. Fluorescence signals were observed at 72° during the elongation step. Each sample was analysed with at least three biological replicates and normalized to the IgG sample. The results were analysed using Light Cycle 480 SoftWare 1.5.1 in the Roche Light Cycler 480II System. All primers used in this study are described in Table S2.

Total RNA was isolated using RNAprep Pure Plant kit (TIANGEN, Beijing, China). To avoid degradation all steps were carried out at low temperature. RNA quantity and quality was determined using both Nanodrop2000-C spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA) and gel electrophoresis. Approximately 1 μg of qualified total RNA of each sample was used to synthesize first strand complementary DNA according to the manufacturer’s instructions of the PrimeScript® RT Reagent kit after gDNA Eraser treatment (TaKaRa, Dalian, China).
Gene-specific primers for qRT-PCR were designed using the NCBI Primer-Blast Tool. Detailed information of all the primers used in this study is listed in Additional file 8: Table S4. qRT-PCR analysis was performed on a LightCycler TM 480 II System (Roche Applied Science, Basel, Switzerland) using LightCycler 480 SYBR green 1 Master mix (Roche). The relative amounts of candidate genes were calculated with the 2^-ΔΔCT method. The cotton histone3 (GenBank: AF024716.1/locus_ID of NAU-NBI, v1.1: Gh_D03G0370) gene was used as the reference gene. All qRT-PCRs were performed in triplicate.

Total RNA was isolated from ARPE-19 cells using Trizol (Invitrogen) and cDNA was synthesized from total RNA using the iScript cDNA synthesis kit (Bio-Rad) in a 20 μL volume. RT-qPCR was performed using a Roche LightCycler^TM 480II system (Roche Diagnostics, Indianapolis, IN, USA) with LightCycler^TM 480 SYBR Green I Master reaction mix (Roche). The sequences of primers used for RT-qPCR are displayed in Supplementary Table S1. mRNA expression levels were normalized to 18S rRNA levels.

We used RNAiso Plus (Takara Biotechnology, Dalian, China) to extract total RNA from cells and then reverse transcribed to synthesize cDNA using Prime Script RT Master Mix (Takara Biotechnology, Dalian, China) according to the instructions of the manufacturer. qRT-PCR was performed using the Sybr Premix Ex Taq TMKit (Takara Biotechnology, Dalian, China) and LightCyclerTM 480 II system (Roche, Basel, Switzerland). Primer sequences were as follows: Forward primer: ACTGCGCCACCTCTGATATG; Reverse primer: GACCCACTGATTGTGCCTGA.

The RNAiso Plus was used to total RNA. The PrimeScript™ RT Master Mix was used to synthesize cDNA. qRT-PCR was then performed using SYBR^® Pre-mix Ex TaqTM (Tli RNaseH Plus) on LightCyclerTM 480II system (Roche, Basel, Switzerland). Reagents above were purchased from Takara Biotechnology (Dalian, China). The primer sequences for SLC39A1 were as follows: F: 5′-GCT​GTT​GCA​GAG​CCA​CCT​TA-3’; R: 5′-CAT​GCC​CTC​TAG​CAC​AGA​CTG-3’. The primer sequences for ACTB were as follows: F: 5′-CAT​GTA​CGT​TGC​TAT​CCA​GGC-3’; R: 5′-CTC​CTT​AAT​GTC​ACG​CAC​GAT-3’. The -ΔΔCT method was applied to quantify the relative genes expression in three independent experiments.

The total RNA was extracted from PBMCs by the QIAzol method, following the manufacturer’s protocol (QIAGEN, Hilden, Germany). The RNA concentration and purity were evaluated using a Nanodrop 1000 (Thermo Fisher Scientific, Rockford, IL, USA). The miR-155-5p and miR-146a-5p expressions were determined using an RT primer assay and hydrolysis probes (Applied Biosystems, CA, USA). The miRNAs were determined using a two-step RT-qPCR with an RT primer specific assay in combination with TaqMan probes (Applied Biosystems, CA, USA). Each RT reaction used 2.5 µL (30 ng of RNA) from the 14 µL eluted RNA using a TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems, CA, USA). The miRNAs were detected and quantified using miRNA assays for miR-155-5p (assay ID 463509_mat, Applied Biosystems, CA, USA), miR-146a-5p (assay ID 001187, Applied Biosystems, CA, USA), and U6 as reference gene (assay ID 001973, Applied Biosystems, CA, USA); 1.5 µL of RT reaction was amplified in 10 µL reactions. PCR was performed using a LightCycler TM 480 II System (Roche Applied Science, Basel, Switzerland) with a LightCycler 480 Probes Master kit (Roche Applied Science). The miRNA relative concentrations were normalized with the Ct values of U6, and values were calculated using the 2^−ΔΔCt method.