The largest database of trusted experimental protocols

Ubi mcs 3flag sv40 puromycin

Manufactured by Genechem
Sourced in China

The Ubi-MCS-3FLAG-SV40-puromycin is a multi-cloning site vector that contains the Ubiquitin (Ubi) promoter, a 3xFLAG tag, and a puromycin resistance cassette. This vector is designed for the expression and purification of recombinant proteins in mammalian cell lines.

Automatically generated - may contain errors

6 protocols using ubi mcs 3flag sv40 puromycin

1

Pancreatic Cancer Cell Line Characterization and Genetic Manipulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
AsPC-1, BxPC-3, Capan-2, Mia PaCa-2, PANC-1, and SW1990 cells were obtained from American Type Culture Collection (ATCC; USA), AsPC-1, BxPC-3, Capan-2, SW1990, and HPDE cell lines were cultured in RPMI 1640 (Gibco, USA), while Mia PaCa-2 and PANC-1 cell lines were grown in DMEM (Gibco, USA). Both medium were supplemented with 10%FBS and 1%Penicillin/Streptomycin. All cell lines were cultured in a humidified atmosphere containing 5%CO2/95% air at 37°C. All the cell lines had been authenticated through STR profiling and confirmed to be mycoplasma-free.
Lipofectamine3000 was purchased from Invitrogen (Invitrogen, USA); 3 small interfering RNAs (siRNA) (st-h-MINDY2-1 GCACAAGCCTCTCCATCAA, st-h-MINDY2-2 GCTGAGCAGTTTCTAAATA, and st-h-MINDY2-3 GTTCGAGTGTTTGAATATA) were provided by RiboBio (China). GeneChem (China) was responsible for designing and manufacturing lentivirus carrying negative control, MINDY2 overexpression vector (Ubi-MCS-3FLAG-SV40-puromycin), MINDY2-encoding short hairpin RNA (shRNA)(hU6-MCS-CMV-Puromycin), and shRNA targeting ACTN4(hU6-MCS-CMV-Puromycin). The directions were strictly followed during every infection or transfection step.
+ Open protocol
+ Expand
2

Overexpression of STAMBP and RAI14

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following plasmids were purchased from GeneChem (Shanghai, China): lentivirus plasmid (Ubi-MCS-3FLAG-SV40-puromycin) carrying the full-length human STAMBP CDS (gene ID: 10617) and lentivirus plasmid (CMV-MCS-HA-SV40-Neomycin) carrying the full-length human RAI14 CDS (gene ID: 26064). Cells were plated at a density of 3 × 105 cells/well and cultured for 24 h. Then, lentivirus was added to the cells at a multiplicity of infection of 10. After transfection for 48 h, 1 µg/ml puromycin (Selleck Chem, S7417) and 2 mg/ml G418 (Sigma, 108321-42-2) were used to select for cells with successfully transfected STAMBP and RAI14 plasmids, respectively.
+ Open protocol
+ Expand
3

Lentiviral Transduction for Gene Modulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Virus packaging was performed in HEK293T cells by co-transfection with lentiviral vectors with the packaging plasmid pHelper 1.0 vector (GeneChem Co., Ltd., Shanghai, China) and the envelope plasmid pHelper 2.0 vector (GeneChem Co., Ltd.) using Lipofectamine 2000 (Invitrogen). At 48 h after transfection, supernatants containing lentiviral particles were collected, and the virus titer was quantified according to the manufacturer’s instructions. Lentiviral vectors encoding short hairpin RNAs (shRNAs) (Sh-1: ATTATTGTAACCACCCGTT; Sh-2 TGAGCAGTATTCCGAGAAA; Sh-3: CAATCATTTCATTGATCTT) targeting OGT were generated using the GV344 vector (hU6-MCS-Ubiquitin-Luc_firefly IRES-puromycin, GeneChem Co., Ltd., Shanghai, China). A scrambled GV344 vector (TTCTCCGAACGTGTCACGT) was used as the negative control. Stable transfectants overexpressing OGT were generated by lentiviral transduction using a GV341 vector (Ubi-MCS-3FLAG-SV40-puromycin, GeneChem Co., Ltd.). An empty vector was used as the negative control. Stable transfectants overexpressing EZH2 were generated by lentiviral transduction using a GV367 vector (Ubi-MCS-SV40-EGFP-IRES-puromycin, GeneChem Co., Ltd.). An empty vector was used as the negative control.
+ Open protocol
+ Expand
4

Lentiviral Overexpression and Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
Virus packaging was performed in HEK293T cells by co‐transfection with lentiviral vectors with the packaging plasmid pHelper 1.0 vector (GeneChem Co., Ltd., Shanghai, China) and the envelope plasmid pHelper 2.0 vector (GeneChem Co., Ltd.) using Lipofectamine 2000 (Invitrogen). At 48 hours after transfection, supernatants containing lentiviral particles were collected, and the virus titre was quantified according to the manufacturer's instructions. Lentiviral vectors encoding short hairpin RNAs (shRNAs) (Sh: ATTATTGTAACCACCCGTT) targeting MYOSLID were generated using the GV344 vector (hU6‐MCS‐Ubiquitin‐Luc_firefly IRES‐puromycin, GeneChem Co., Ltd., Shanghai, China). A scrambled GV344 vector (TTCTCCGAACGTGTCACGT) was used as the negative control. Stable transfectants overexpressing MYOSLID were generated by lentiviral transduction using a GV341 vector (Ubi‐MCS‐3FLAG‐SV40‐puromycin, GeneChem Co., Ltd.). An empty vector was used as the negative control.
+ Open protocol
+ Expand
5

Lentiviral Overexpression and Knockdown of PHF19

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentivirus overexpressing PHF19 CDS (Ubi-MCS-3FLAG-SV40-puromycin) and PHF19 shRNAs (hU6-MCS-CMV-Puromycin) were produced by GeneChem (Shanghai, China) as previously described (Tao et al., 2018b (link)). The oligonucleotides synthesized for construction of PHF19 shRNA plasmids were as follows: PHF19 shRNA -1: CCGGCCTCGTGACTTTCGAAGATAACTCGAGTTATCTTCGAAAGTCACGAGGTTTTTG; PHF19 shRNA -2: CCGGCCCACCTCAAGTCATCTATCACTCGAGTGATAGATGACTTGAGGTGGGTTTTTG.
+ Open protocol
+ Expand
6

Lentiviral-Mediated LHPP Overexpression

Check if the same lab product or an alternative is used in the 5 most similar protocols
SCC15 and SCC25 cells were trans ducted with lentivirus: Ubi-MCS-3FLAG-SV40-puromycin (Genechem, Shanghai, China) at a multiplicity of infection (MOI) of 50 and 20 for 14h, HitransG P and HitransG A virus infection reagents were added, respectively, then co-culture with 1ug/ mL and 5ug/ mL puromycin for 14 days, finally, we obtained the SCC15 and SCC25 cells line that stably expressed LHPP. The full-length transcript of LHPP was in NM_022126.4. The OE-LHPP group is the cells that overexpress LHPP. The Vector group is the control blot for OE-LHPP, that is, it is infected with lentivirus but does not express LHPP. The OE-LHPP group cells were pretreated with 8μg/ml AKT activator SC79 or treated with 10 μM PI3K inhibitor LY294002, which were bought from MedChemExpress.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!