Sybr green primers

Isolated macrophages in the range of 10,000–50,000 were subjected to total RNA extraction using miRNeasy RNA extraction micro kit (Qiagen) following manufacturer’s instructions. Absolute quantification using real-time quantitative PCR (qPCR) method was used to measure RNA concentration. A standard curve was created with serial dilutions of RNA from a known concentration obtained from monocytes isolated from fresh human blood by Ficoll gradients using CD14⁺-isolating MACS columns. Quantification was performed by beta-2-microglobulin presence using SyBR-Green primers (Sigma). RNA quality was assessed in the bioanalyzer using RNA 6000 pico chips (Agilent) and RNAs with a RIN quality value ≥8.50 were used for the pre-amplification and library preparation procedures.

Total RNA was extracted using GenElute mammalian total RNA miniprep kit (Sigma-Aldrich). Reverse transcription was performed starting from 175 ng RNA using GoScript^TM reverse transcription system (Promega). cDNAs were subjected to quantitative PCR using predesigned SYBR green primers (Sigma-Aldrich; Supplementary Table 2) and SYBR Green JumpStart Taq ReadyMix^TM (Sigma-Aldrich). Gene expression levels were assessed in triplicate using ViiA7 thermal cycler (Applied Biosystems) and the average expression level across triplicates (e) was relativized to the average expression level of β-2-microglobulin (c):
$r=e-c$
where r is the relative gene expression.
The fold change (fc) between the relative gene expression after KD (r_KD) and the relative gene expression in the control condition (r_c) was calculated as:
$f_c={\text{2}}^{\left(r_c-rKD\right)}$
Each experiment was repeated in biological duplicate.

The RNeasy Mini kit (Qiagen) was used to get total mRNA extracts. In a final volume of 20 μL, 1 μg of RNA was retrotranscribed using the Improm-II Reverse Transcription Set (Promega), according to the manufacturer’s protocol. Real-time PCR was used to evaluate gene expression using specific SYBR Green primers provided by Sigma-Aldrich Company (see table below). According to the formula below, the fold change was calculated: Fold increase = 2^-(CT of target gene − CT of the house-keeping gene). Primers applied were as follows:

h-Sema6C-S	5′-CTTCGGCTCAACTGCTCTGT
h-Sema6C-AS	5′-AACCCACGCTCAATCTCATC
h-GAPDH-S	5′-TTGTTGCCATCAATGACCC
h-GAPDH-AS	5′-CCTCCCGTTCTCAGCCTTG

RNA was extracted and purified from the superior and middle right lung lobes using TRIzol Reagent (Life Technologies Corporation, Carlsbad, CA, USA) and RNeasy Mini Kit (QIAGEN GmbH, Hilden, Germany) according to the manufacturer’s instructions. cDNA was synthesized using iScript cDNA Synthesis Kit (Bio-Rad Laboratories, CA, US) according to the manufacturer’s instructions. Real-time quantitative PCR was performed using Power SYBR® Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) and SYBR® Green primers (Sigma-Aldrich) for collagen, type I, alpha 1 (Col1a1) (forward: ACGCATGGCCAAGAAGACA, reverse: TACAGATCAAGCATACCTCGGGTT), collagen, type III, alpha 1 (Col3a1) (forward: CTAGACTGCCCCAACCCAGA, reverse: AGGTCCATGGCCATCAGGA) and collagen, type V, alpha 1 (Col5a1) (forward: GCCCGGGCCTGAAGAGTA, reverse: CCACTTGCCATCGGACAAG). Primers for the housekeeping genes glyceraldehyde-3-phosphate dehydrogenase (Gapdh) (forward: CATGGCCTTCCGTGTTCCTA, reverse: TGCTTCACCACCTTCTTGATG) and beta-actin (Actb) (forward: TGGGTCAGAAGGACTCCTATGTG, reverse: CGTCCCAGTTGGTAACAATGC) were also included. Quantification was performed on Bio-rad CFX96 Real-Time PCR Detection System and relative quantitation (RQ) was calculated using the comparative C_T (2^−ΔΔCt) method. Expression of the gene of interest was then normalized to Gapdh.

Total mRNA was isolated from kidney tissues using TRIzol Reagent (LifeTechnologies, CA, USA). First strand cDNA was generated using M-MLV Reverse Transcriptase, RNase H, Point Mutant Kit (Promega, Madison, WI, USA). Genes of interest were measured using pre-optimized SYBR green primers (Sigma-Aldrich) and RT-PCR master mix (LifeTechnologies, CA, USA). The primers used in real-time RT-PCR experiments were as follows: macrophage chemoattractant protein (MCP)-1 forward primer: 5′-GTTGTTCACAGTTGCTGCCT-3′, and reverse primer: 5′-CTCTGTCATACTGGTCACTTCTAC-3′. Interleukin (IL)-1α, IL-6 and cluster of differentiation (CD) 68 mRNA expressions were measured using Taqman probe (IL-1α: ACCTGCAACAGGAAGTAAAATTTGA, NCBI gene references: NM_010554.4, mCT192405.0, BC003727.1, ID: Mm00439620_m1; IL-6: ATGAGAAAAGAGTTGTGCAATGGCA, NCBI gene references: NM_031168.1, X06203.1, X54542.1, ID: Mm00446190_m1; CD68: CACTTCGGGCCATGTTTCTCTTGCA, NCBI gene references: NM_001291058.1, ID: Mm03047343_m1). The average expression of the control group was assigned as the calibrator against which all other samples were expressed as fold difference. The 18S rRNA was used as the house-keeping gene for all gene of interest.

The vectors pCMVHA E2F1^{66 (link)} (Item ID 24225, Addgene), pLX_TRC317 (TRCN0000481188, Sigma-Aldrich) and pcDNA3.1 + /C-(K)-DYK (Clone ID: OHu19407D, Genscript) were used to induce E2F1, MCM7, and PAK1 overexpression, respectively. FLO-1 cells were transfected according to the manufacturer’s protocol, while CP-A cells were nucleofected following the Neon™ kit protocol (Thermo Fisher), with 2 pulses of 1200 V for 20 ms. Overexpressing cells were selected with either G481/Geneticin (E2F1, PAK1) or Puromycin (MCM7). Empty vectors carrying G418 (pcDNA3.1 + /C-(K)-DYK, Genscript) or Puromycin (Item ID 85966, Addgene) resistance were used as controls. The RNA from transfected cells was used to assess gene overexpression via quantitative RT-PCR using predesigned SYBR green primers (Sigma-Aldrich; Supplementary Table 3) and Brilliant III Ultra-Fast SYBR Green QRT-PCR Master Mix (Agilent Technologies). The average expression level across triplicates (e) was relativised to the average expression level of β-2-microglobulin (c): $r=e-c$ where r is the relative gene expression. The fold change (fc) between the relative gene expression after overexpression and the relative gene expression in the control condition (r_c) was calculated as: $fc=2^{\left(r_c-rKD\right)}$
Each sample was assessed in triplicate and each experiment was repeated in biological duplicate.

Total RNA was extracted from the kidney using Trizol (Life Technology, CA, USA). First strand cDNA was generated using Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics, Mannheim, Germany). rt-PCR was performed using pre-optimized SYBR Green primers (Sigma-Aldrich, Table 1) and rt-PCR master mix (Life Technology, CA, USA) as previously described [21] (link). The average mRNA expression of the Control group was used as the calibrator and 18S rRNA was used as the housekeeping gene [21] (link).