Rnase free water

Manufactured by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Germany, Denmark, Ireland, France

RNase-free water is a high-purity water product designed for use in RNA-based applications. It is treated to remove RNase enzymes that could degrade RNA samples. RNase-free water provides a consistent, reliable source of water for maintaining the integrity of RNA during various experimental procedures.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

UltraPure™ DNase/RNase-Free Distilled Water (172 citations) DNase/RNase-free water (111 citations) DNase/RNase-free distilled water (39 citations) UltraPure DNase/RNase-Free water (27 citations) DNase and RNase-free water (19 citations) DEPC-treated RNase-free water (5 citations) RNase-free distilled water (4 citations) Invitrogen™ DNase/RNase-Free Distilled Water (4 citations) RNase-free molecular-biology-grade water (4 citations) Ultrapure DNase/RNase-free distilled water (vehicle) (2 citations)

220 protocols using rnase free water

Preparation and Injection of Synthetic Melanin and Chemical Compounds

Check if the same lab product or an alternative is used in the 5 most similar protocols

HG 9-91-01 (MedChem Express) was dissolved in DMSO to create a stock solution of 200 mM. Then, with 200-µM aliquots diluted with RNase-free water (Ambion), HG 9-91-01 was injected at concentrations stated in the paper in Figs. 2 and 3. When used with cRNA, HG 9-91-01 was mixed and coinjected. For example, the 200 µM HG 9-91-01 was mixed 1:1 with 2,000 ng/μl cRNA of nonconductive Shaker constructs for injecting 100 µM. DMSO concentration, when injected into the oocyte, was less than 0.1%. Since the volume of an oocyte is ∼1 μl and we injected 50.1 nl, the final concentration of HG 9-91-01 inside the oocyte was ∼4.7 µM.
For synthesis of synthetic melanin with an average diameter of 200 nm, 3 ml ammonia aqueous solution (NH₄OH, 28–30%; Sigma) was mixed with 40 ml of 200-proof ethanol (Decon Laboratories) and 90 ml Milli-Q water (Millipore) with mild stirring at 30°C for 30 min. 0.5 g dopamine hydrochloride (Sigma) was dissolved in 10 ml Milli-Q water and injected into the above solution. The color of the solution immediately turns pale yellow and quickly darkens to brown. The reaction was left at room temperature for 24 h. The melanin mixture was centrifuged and rinsed with copious amounts of Milli-Q water. To create different concentrations, the melanin was dried, and weighed, and resuspended in RNase-free water (Ambion) before injection.

Lee E.E, & Bezanilla F. (2019). Methodological improvements for fluorescence recordings in Xenopus laevis oocytes. The Journal of General Physiology, 151(2), 264-272.

+ Open protocol

+ Expand

Bacterial RNA Extraction Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Ribopure bacterial RNA extraction kit (Ambion) and TRIzol Max Bacterial RNA Isolation kit (Invitrogen) were used to extract total RNA following the manufacturer's instructions. Steps described as optional but that may improve quality or yield of RNA were followed and every effort made to ensure that the extracted RNA using each method met the manufacturer's guidelines, including the number of E. coli cells used for the extractions. However, no DNAse I treatment was performed for any RNA sample used in this study. For TRIzol® Max Bacterial RNA Isolation, RNA pellet was dissolved in 100 µL RNase-free water (Ambion). For Ribopure™ bacterial RNA extraction, the RNA was eluted in 100 µL RNase-free water (Ambion).

Nwokeoji A.O., Kilby P.M., Portwood D.E, & Dickman M.J. (2016). RNASwift: A rapid, versatile RNA extraction method free from phenol and chloroform. Analytical biochemistry, 512.

+ Open protocol

+ Expand

RNA Extraction and qPCR Analyses of PBMCs

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was purified from freshly thawed (U)PBMC using the Qiagen RNeasy Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. The RNA yield was quantified with the Qubit RNA broad range (BR) assay in combination with a Qubit spectrophotometer (Life Technologies). Samples were stored in RNase free water (Life Technologies) at −20 °C for a maximum of 7 days prior to cDNA transcription (see SI, section for further details). As previously reported [9 (link)] we selected Succinate dehydrogenase complex, subunit A, flavoprotein variant (SDHA) and Importin 8 (IPO8) as gene expression references. Detailed information about the gene expression analyses and the selection procedure of appropriate house-keeping genes for human (U)PBMC is given in the SI, section 4.

Ramo-Fernández L., Gumpp A.M., Boeck C., Krause S., Bach A.M., Waller C., Kolassa I.T, & Karabatsiakis A. (2021). Associations between childhood maltreatment and DNA methylation of the oxytocin receptor gene in immune cells of mother–newborn dyads. Translational Psychiatry, 11, 449.

+ Open protocol

+ Expand

RNA Extraction and RT-qPCR Workflow

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using TRIzol (Life Technologies) according to manufacturer’s instructions.³⁴ During RNA precipitation, glycogen (Life Technologies) was used to visualize the RNA pellet. The RNA pellet was then dissolved in RNAse-free water (Life Technologies). Quantitative real-time PCR was performed as previously described.^{13 (link)} Additional details are available in the Supplementary Methods.

Liu X., Rothe K., Yen R., Fruhstorfer C., Maetzig T., Chen M., Forrest D.L., Humphries R.K, & Jiang X. (2017). A novel AHI-1–BCR-ABL–DNM2 complex regulates leukemic properties of primitive CML cells through enhanced cellular endocytosis and ROS-mediated autophagy. Leukemia, 31(11), 2376-2387.

+ Open protocol

+ Expand

Intracerebroventricular Infusion of Mincle siRNA

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Intracerebroventricular infusion was performed as previously described^{7 (link)}. Briefly, Post-anesthetized rats were placed into a stereotaxic apparatus under 2% isoflurane anesthesia during the whole procedure. Three different formats of Mincle siRNA (500pmol/5µl RNase-free water^{7 (link)}, Life Technologies), scramble siRNA, (500pmol/5µl, Thermo Scientific Dharmacon) and rSAP130 Protein (50ng/5µl^{17 (link)}, Abnova corporation) was delivered into the left ventricle through a burr hole at the following coordinates relative to bregma: 1.5 mm posterior, 1.0 mm lateral, and 3.2mm beneath the dural surface using a 10µl Hamilton syringe (Microliter 701; Hamilton Company, Reno, NV). In order to enhance the gene silence efficiency, three different Mincle siRNA were mixed, listed as follows: 1) 5'CACCUUAUCCUGGCUAUCAAGUCUA3'; 2) 5'GCUCACCUGGUGGUUAUCAACACAU3'; 3) 5'CCUGUUUCUUCAGUAUGCCUUGGAU3'. All the chemicals were injected by a pump at a rate of 0.5 µl/min. The syringe was kept in place for 5 min after infusion and then slowly removed. Mincle siRNA and scramble siRNA were injected at 24h before SAH induction. Exogenous SAP130 (rSAP130) was injected at 1.5h after SAH. The Syk phosphorylation inhibitor piceatannol was injected intraperitoneally at 1h after SAH.

He Y., Xu L., Li B., Guo Z., Hu Q., Guo Z., Tang J., Chen Y., Zhang Y., Tang J, & Zhang J.H. (2015). Mincle/Syk Signaling Pathway Contributes to Neuroinflammation after Subarachnoid Hemorrhage in Rats. Stroke; a journal of cerebral circulation, 46(8), 2277-2286.

+ Open protocol

+ Expand

Serum miRNA Isolation and Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA containing small RNA, including miRNAs, was isolated by using the mirVana PARIS Kit (Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions, with a few added modifications, as reported in the next paragraph. We added 250 μL serum from each sample to a 1.5 mL RNase-free tube mixed with Denaturing Solution Master Mix, including 2x Denaturing Solution, 1 μg carrier MS2 bacteriophage RNA (Roche Applied Science, Basel, Switzerland) and 25 fmol cel-miR-39 spike-in oligos (Life Technologies). The purified serum RNA was eluted with RNAse-free water (Life Technologies) and was stored at -70°C until further experiments. The RNA concentration was measured by using the NanoDrop 1000 (NanoDrop, Wilmington, DE, USA). The efficiency of RNA recovery among the samples was evaluated by measuring cel-miR-39 expression, by using quantitative real-time PCR (QRT-PCR) analysis.

Li S.C., Khan M., Caplin M., Meyer T., Öberg K, & Giandomenico V. (2015). Somatostatin Analogs Treated Small Intestinal Neuroendocrine Tumor Patients Circulating MicroRNAs. PLoS ONE, 10(5), e0125553.

+ Open protocol

+ Expand

Quantitative RNA Extraction and Measurement

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fifty mg of homogenized shoot tissue or 100 mg of homogenized root tissue was extracted in 1ml of TRIzol Reagent (Thermo Fisher Scientific, United States) according to manufacturers’ instructions. After air-drying the RNA, it was resuspended in 40 μl of RNase-free water (Life Technologies) and incubated at 60°C for 15 min. RNA was quantified using the Quant-iT RNA Assay Kit (Life Technologies). This kit is intended for quantification of total RNA, rRNA and mRNA > 20 nucleotides in length. Ten μl of diluted RNA within the range of 5–100 ng in 200 μl final volume was prepared according to manufacturers’ instructions and aliquoted in to a black-walled, clear-bottom 96-well microplate (Molecular Probes^®, Thermo Fisher Scientific, United States). Fluorescent signals were measured using a microplate reader (Optima, BMG LABTECH) with Excitation/Emission maxima of 640/690 nm.

Melino V.J., Casartelli A., George J., Rupasinghe T., Roessner U., Okamoto M, & Heuer S. (2018). RNA Catabolites Contribute to the Nitrogen Pool and Support Growth Recovery of Wheat. Frontiers in Plant Science, 9, 1539.

+ Open protocol

+ Expand

Synthesis and Characterization of Anti-miR Oligonucleotides

Check if the same lab product or an alternative is used in the 5 most similar protocols

Anti-miR and antago-miR oligonucleotides were synthesized with the following sequence: 5’ – ACU GCC UGU CUG UGC CUG CUG T – 3’ (Eurofins Genomics). Both oligonucleotides were designed with 2’ O-methylation, 4 PTO-linkages on the 3’ end, and 2 PTO-linkages on the 5’ end. The antago-miR was further modified with a 3’ cholesterol group. For release experiments requiring miRNA detection via fluorescence measurements, a Cy3 dye molecule was conjugated to the 5’ end. All lyophilized anti-miR or antago-miR aliquots were resuspended with RNase-free water (Life Technologies) to a final concentration of 100 μM.

Hernandez M.J., Gaetani R., Pieters V.M., Ng N.W., Chang A.E., Martin T.R., van Ingen E., Mol E.A., Sluijter J.P, & Christman K.L. (2018). Decellularized Extracellular Matrix Hydrogels as a Delivery Platform for MicroRNA and Extracellular Vesicle Therapeutics. Advanced therapeutics, 1(3), 1800032.

+ Open protocol

+ Expand

Denaturing Polyacrylamide Gel Electrophoresis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tris-HCl (1 M solution), MgCl₂ (1 M solution), and RNAse-free water (non-DEPC-treated) were from Life Technologies (Woburn, MA). Hand-poured denaturing polyacrylamide gels (20%) were prepared using the UreaGel concentrate/diluent system from National Diagnostics (Atlanta, GA). Pre-cast denaturing polyacrylamide gels (15%) were Novex TBE-Urea gels from Life Technologies (Woburn, MA). TBE (in hand-poured gels and running buffer) was 1 ×, prepared from a 10 × stock solution (0.89 M tris, 0.89 M boric acid, 0.01 M EDTA). Track-etched membranes for vesicle extrusion were Nucleopore brand from Whatman/GE (Little Chalfont, Buckinghamshire, UK). Other reagents and solvents were from Sigma (St. Louis, MO), Fisher (Waltham, MA), or VWR (Radnor, PA).

Engelhart A.E., Adamala K, & Szostak J.W. (2016). A simple physical mechanism enables homeostasis in primitive cells. Nature chemistry, 8(5), 448-453.

+ Open protocol

+ Expand

Quantification of Inner Ear lncRNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Inner ears or the sensory epithelium of the cochlea and vestibule were dissected, frozen in liquid nitrogen, and stored at −80 °C. Total RNA was extracted by the RNeasy Plus Mini Kit (Qiagen) and diluted in RNase-free water (Life Technologies). The Mouse Total RNA Tissue Panel (Clontech) was used to examine the presence and the level of the expression of lncRNAs in various tissues. cDNA was prepared from 1 ug of RNA using the High Capacity cDNA Reverse Transcription Kit with random hexamers (Applied Biosystems). mRNA expression was evaluated using the Fast SYBR® Green Master Mix (Applied Biosystems) in the StepOneTM Real-Time PCR System (Applied Biosystems).
Primers were designed for 80–150 base-pair (bp) segments using Primer3 (http://bioinfo.ut.ee/primer3/). All primers were validated, including the amplification efficiency and correlation coefficient (R²) of each primer pair; samples were examined using a standard curve with five cDNA dilutions. In addition, a melt curve was performed to verify the specificity of the primers. Primers are available upon request. No template control (NTC) samples were included as negative controls. The 2^−ΔΔCt method was used to calculate the expression of each lncRNA. mRNA expression was normalized to Gapdh. Cochlear tissue from postnatal day 0 was used as the control sample. The data in the figures are presented as the mean ± SD.

Ushakov K., Koffler-Brill T., Rom A., Perl K., Ulitsky I, & Avraham K.B. (2017). Genome-wide identification and expression profiling of long non-coding RNAs in auditory and vestibular systems. Scientific Reports, 7, 8637.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!