Total RNA was extracted from cells using Tissue RNA Purification Kit (EZBioscience, Roseville, MN, USA), and 1 μg was reverse-transcribed using PrimeScript™ RT Master Mix (TaKaRa, Tokyo, Japan). Real-time PCR was performed using ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China). Target gene expression was normalized to GAPDH levels in three experimental replicates per sample. For primer sequences, please see Supplementary Table S7 .
Tissue rna purification kit
Manufactured by EZBioscience
Sourced in United States
The Tissue RNA Purification Kit is a laboratory tool designed to extract and purify total RNA from various tissue samples. It utilizes a specialized protocol and reagents to efficiently isolate high-quality RNA suitable for downstream applications, such as gene expression analysis and qRT-PCR.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop 2000, by Thermo Fisher Scientific (4 mentions)
Color reverse transcription kit, by EZBioscience (3 mentions)
Hiscript 3 rt supermix for qpcr, by Vazyme (2 mentions)
Aceq universal sybr qpcr master mix, by Vazyme (2 mentions)
Nanodrop 2000c, by Thermo Fisher Scientific (2 mentions)
Nanodrop one, by Thermo Fisher Scientific (2 mentions)
Primescript rt master mix, by Takara Bio (1 mentions)
Chamq universal sybr qpcr master mix, by Vazyme (1 mentions)
Nanodrop one spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Quantstudio 6 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Cfx96, by Bio-Rad (1 mentions)
Reverse transcription kit, by EZBioscience (1 mentions)
Sybr green, by Yeasen (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Itaq universal sybr green supermix, by Bio-Rad (1 mentions)
Hiscript 3 rt supermix, by Vazyme (1 mentions)
Cfx connect, by Bio-Rad (1 mentions)
Abi 7500 rt pcr instrument, by Thermo Fisher Scientific (1 mentions)
Quantstudio 6 flex, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
10 protocols using tissue rna purification kit
1
Quantitative Gene Expression Analysis
2
Quantifying Gene Expression in Liver and Ileum
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA in liver and ileum tissues was isolated using a tissue RNA purification kit (EZBioscience, Roseville, MN, United States). The total RNA of each sample was quantified by a spectrophotometer (NanoDrop™ 2000C; Thermo Fisher, Waltham, MA, United States). Complementary (c)DNA synthesis was done using HiScript™ III RT SuperMix for qPCR (Vazyme, Nanjing, China). RT-qPCR primers were designed and synthesized (Sangon Biotech, Shanghai, China) and the sequences are listed in Table 1 . RT-qPCR was undertaken using AceQ Universal SYBR® qPCR Master Mix (Vazyme) on an ABI QuantStudio seven Flex RT-PCR system (Applied Biosystems, Foster City, CA, United States ). The values of the target genes were normalized to that of glyceraldehyde 3-phosphate dehydrogenase (Gapdh) and the 2−ΔΔCt method was used to determine relative expression of target genes.
3
Quantification of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from liver and ileum tissues using a tissue RNA purification kit (EZBioscience, Roseville, MN, USA), according to the manufacturer's instructions. The quantity and purity of RNA was determined using a NanoDrop One spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). RNAs were reverse transcribed using a HiScript™ III RT SuperMix for qPCR (Vazyme, Nanjing, China), according to the manufacturer's instructions. RT-qPCR was performed using AceQ Universal SYBR® qPCR Master Mix (Vazyme), an ABI QuantStudio 7 Flex RT-PCR system (Applied Biosystems, Foster City, CA, USA), and the primers shown in Table 1 . The levels of target gene mRNAs were quantified and normalized relative to the levels of glyceraldehyde 3-phosphate dehydrogenase (Gapdh) mRNA in the same samples.
4
Placental RNA Extraction and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from placental tissues was extracted with the reagent box of a Tissue RNA Purification Kit (EZBioscience, Suzhou, China) as instructed by the manufacturer. The concentration of RNA was quantified using a NanoDrop-2000 (Thermo Fisher, USA). After reverse transcription using a Color Reverse Transcription Kit (EZBioscience, Suzhou, China), qRT-PCR was conducted using SYBR Green on a QuantStudio 6 RealTime PCR System (Thermo Fisher, USA) under the conditions of denaturation at 95 °C for 10 min, amplification at 95 °C for 15 s and 60 °C for 1 min for 40 cycles. Each target gene was individually normalized to the reference gene 18S rRNA by using the quantification method of 2−ΔΔct. Primers used in this study are shown in Supplemental Table S3 .
5
Quantification of Rat Liver Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RT-qPCR was used to detect the expressional levels of candidate targets. Total RNA was extracted from rat liver tissues using a lysis buffer with a Tissue RNA Purification Kit (#RN001A, EZBioscience) according to the manufacturer’s instructions. After determining the concentration and purity of the RNA using a nucleic acid quantitative analyzer (NanoDrop One, ThermoFisher Scientific Inc.), reverse transcription was conduceted using a Color Reverse Transcription Kit (#A0010CGQ, EZBioscience). RT-qPCR was then performed with (ROX2 Plus) 2xColor SYBR Green qPCR Master Mix (#A0012R2, EZBioscience) on an fluorescence quantitation PCR system (CFX96, Bio-Rad). Relative mRNA expression levels were normalized to β-actin (ACTB). The measurement results were expressed as 2−△△CT. Primer sequences used in this study are listed in Supplementary Material 2.
6
Evaluating Osteogenic Differentiation of rBMSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
rBMSCs were seeded in a 6-well plate (1 × 105 cells/well) and cultured overnight. They were subsequently treated with Co-MMSNs (final concentration 10 μg/mL) for 7 days, total RNA was extracted using a tissue RNA Purification Kit (EZBioscience, USA), and the RNA was reverse-transcribed using the Reverse Transcription Kit (EZBioscience), according to the manufacturer’s instructions. All q-PCR reactions were performed in triplicate using a 10 mL reaction system (Takara, Japan), including cDNA, primers, and SYBR-green mix. The following protocol was used to perform PCR: a 10-minute denaturation stage at 95 °C followed by 40 cycles of 15s at 95 °C and 60s at 60 °C. Table 1 contains information on the gene-specific primers. The 2-ΔΔCT method was used to assess the relative quantification of gene expression.
Primer Sequences
| Gene | Forward (5’–3’) | Reverse (5’–3’) |
|---|---|---|
| ALP | CCGCAGGATGTGAACTACT | GGTACTGACGGAAGAAGGG |
| Runx2 | ACTTCCTGTGCTCGGTGCT | GACGGTTATGGTCAAGGTGAA |
| OCN | CAGACAAGTCCCACACAGCA | CCAGCAGAGTGAGCAGAGAGA |
7
Quantifying Sema3F and Npn-2 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with Tissue RNA Purification Kit (EZBioscience, USA). Five hundred nanograms of RNA of each sample was reverse transcribed with PrimeScript™ RT reagent Kit (TAKARA, Japan). Real-time quantitative PCR (qPCR) was performed using SYBR Green (YEASEN, China) according to the manufacturer’s instructions. The primers included the following: Sema3F forward 5′-TCAACAAGTGGAGCACATTC-3′, reverse 5′-ACAGTGGTGAGGCGGTAG-3′; Npn-2 forward 5′-TGGATGTACGACCGTGCCAAGTGG-3′, reverse 5′-CTGATACTCCATGTCATAG CTGGG-3′; actin forward 5′-ACCCCGTGCTGCTGACCGAG-3′, reverse 5′-TCCCGGCCAGCCAGGTCCA-3′. The relative content was examined using the 2−ΔΔCq method [21 (link)].
8
Quantifying Adipogenic Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total back-fat tissue RNA was extracted via a Tissue RNA Purification Kit (EZBioscience, Roseville, CA, USA) and was reversely transcribed to cDNA using HiScript® III RT SuperMix (Vazyme Biotech, Nanjing, China). The mRNA expression levels of IRX3, THY1, PLIN4, LPL, CFD, SREBP1, C/EBPα, C/EBPβ, C/EBPδ, and ATGL genes were checked with iTaqTM Universal SYBR® Green Supermix (Bio Rad, Hercules, CA, USA) on a real-time PCR (CFX Connect, Bio Rad, Hercules, CA, USA), and data were analyzed by the ΔΔCt method with β-actin as the internal reference. All primers and thermocycling conditions were followed as Table S3 [24 (link),25 (link),26 ,27 (link)]. Each qPCR reaction was repeated in triplicate.
9
Quantitative RT-PCR Analysis of nNOS and GAPDH
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time polymerase chain reaction (RT-PCR) protocol was referred to in our previous research (35 (link)). Homogenizing tissues extracted total RNA by using EZBioscience Bio Tissue RNA purification Kit (Roseville, CA, USA) and single standard cDNA was synthesized by using a color reverse transcription kit (Roseville, CA, USA). Quantitative RT-PCR was performed with Thermo Scientific ABI-7500 RT-PCR instrument. The primers used were as follows: nNOS forward 5′-GTC AGA AGA TGT CCG CAC CAA GG-3′ and reverse 5′-TGT TCA CCT CCT CCA GCC TGT C-3′; GAPDH forward 5′-TGT GTC CGT CGT GGA TCT GA-3′ and reverse 5′-TTG CTG TTG AAG TCG CAG GAG-3′.
10
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues using TRIzol (Invitrogen, USA) and a tissue RNA purification kit plus (EZBioscience, USA). cDNA was synthesized using HyperScript III RT SuperMix for quantitative PCR (qPCR) with genomic DNA (gDNA) remover (EnzyArtisan, China). A NanoDrop2000 equipment (Thermo Scientific, USA) was used to measure the concentration of RNA or DNA. With QuantStudio 6 Flex real-time PCR systems, the real-time PCR was carried out according to the procedure listed below (Thermo Scientific, USA): predenaturation (95 °C for 30 s), 40 amplification cycles of denaturation (95 °C for 10 s), and annealing and extension (60 °C for 30 s). Gene expression was measured by the 2−ΔΔCT method. The detection primers are listed in Table S1.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!