Untreated and TGF-β1 treated HaCaT and HK-2 cells were fixed with formaldehyde for protein-DNA crosslinking followed by a 10 minute incubation with a final concentration of 125 mM glycine followed by nuclear lysate isolation (as above) and sonication to generate DNA fragments (~50–200 base pairs) used for ChIP analysis. 3 μg of ChIP-competent p53 (Active Motif) and SMAD3 (Abcam) antibodies were added to immunoprecipate DNA fragments bound by p53 or SMAD3, respectively. Real Time PCR reactions performed in a Bio-Rad iCycler iQ™ Real-Time PCR Detection System, using a mixture of Sybr Green® (Qiagen) and PAI-1 promoter primers (forward: CAACCTCAGCCAGACAAGGT; reverse: CTGAGGCATGTGTGTGTGTG) under optimizing PCR cycle conditions (10 minute 95°C; 45 cycles 95°C for 20s, 55°C for 30s, 72°C for 30s). Threshold cycle graphs yielded Ct values for each ChIP reaction. Calculated ΔΔCt values represent the increase of p53 or SMAD3 bound to the PAI-1 promoter.
Smad3
Manufactured by Abcam
Sourced in United States, United Kingdom, China
Smad3 is a transcription factor that plays a key role in the TGF-β signaling pathway. It functions as a regulator of transcription and is involved in the transduction of extracellular signals from TGF-β into changes in gene expression.
Automatically generated - may contain errors
Lab products found in correlation
P smad3, by Abcam (35 mentions)
Smad2, by Abcam (15 mentions)
α sma, by Abcam (13 mentions)
Tgf β1, by Abcam (12 mentions)
Gapdh, by Abcam (9 mentions)
P smad2, by Abcam (8 mentions)
Smad2, by Cell Signaling Technology (7 mentions)
Vimentin, by Abcam (7 mentions)
Fibronectin, by Abcam (6 mentions)
E cadherin, by Abcam (5 mentions)
Collagen 1, by Abcam (5 mentions)
β actin, by Santa Cruz Biotechnology (5 mentions)
Phospho smad3, by Abcam (5 mentions)
β actin, by Abcam (5 mentions)
Smad7, by Abcam (5 mentions)
P smad3, by Cell Signaling Technology (5 mentions)
Pvdf membrane, by Merck Group (5 mentions)
β actin, by Merck Group (5 mentions)
Snail, by Abcam (4 mentions)
Ripa lysis buffer, by Beyotime (4 mentions)
81 protocols using smad3
1
ChIP-qPCR Analysis of p53 and SMAD3 Binding
2
Protein Expression Analysis via Western Blot
3
Protein Expression Analysis of Irradiated Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The protein of collagen type I, TGF-β1, Smad3, and Smad7 were measured in 48 hours after last irradiation. Cells were lysed in lysis buffer (50 mM Tris [pH 7.4], 150 mM NaCl, 0.1% NP 40, 1% sodium dodecyl sulfate [SDS], 0.5% deoxycholic acid, 1 mM EDTA, protease and phosphatase inhibitors). Samples were separated on 10% SDS-polyacrylamide gels and transferred onto polyvinyldenefluoride membranes. The protein blots were incubated with antibodies against collagen type I (Abcam, Cambridge, MA, USA), TGF-β1 (GeneTex, Irvine, CA, USA), Smad3 (Epitomics, Burlingame, CA, USA), Smad7 (Santa Cruz Biotechnology, Santa Cruz, CA, USA) and actin (Santa Cruz Biotechnology). Detection was performed via enhanced chemiluminescence (Amersham Biosciences, Buckinghamshire, UK). The intensity of each band was quantified using Image J and the data were reported as relative intensity according to actin.
4
Antibody Validation for Cell Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
These antibodies were used in the present investigation: Kindlin-1 (Millipore, MA), c-myc (Snail (Millipore), E-cadherin (Abcam), N-cadherin (Epitomics), p-Smad3 (Abcam), Smad2 (Epitomics), Smad3 (Epitomics), SARA (Epitomics), TβRI (Santa Cruz, CA), TβRII (Santa Cruz, CA), Vimentin (Epitomics), YY-1 (Santa Cruz, CA), Actin (Santa Cruz), or Flag (Sigma-Aldrich, St. Louis, MO).
5
Comprehensive Protein Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were washed with cold PBS and lysed in 100 mM Tris-HCl (pH 6.8), 4% SDS, and 20% glycerol, and then protein were separated by SDS-PAGE. The protein was transferred to a 0.2 μm nitrocellulose membrane (Bio-Rad Laboratories). Membranes were blocked with 0.1% casein in TBS. Immunoblotting was performed with the following antibodies: caveolin-1, pan-cytokeratin, E-cadherin, Erk 1/2, p-Erk 1/2 (Thr202/Tyr204), MEK1/2, p-MEK1/2 (S217/221), p-S6 (Ser240/244), p-S6 (Ser235/236), S6, p-Akt T308, p-Akt S473, Akt, p90RSK S380, α-tubulin (Cell Signaling Technology), fibronectin, ERα, smad3 (Epitomics), Snail, vimentin (Abcam), actin (Sigma), and ZEB1 (Bethyl). The immunoblots were visualized using the Odyssey IR imaging system and software (Li-Cor Biosciences).
6
Tissue Protein Profiling Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissues (50 mg) were isotonically lysed using a Dounce homogenizer in 0.25 ml of 10 mM Tris maleate (pH 7.0) buffer with protease inhibitors (Complete inhibitors from Roche). Samples were centrifuged at 8000 × g for 20 minutes and the protein concentrations of the supernatants were determined by Bradford assay. To determine protein levels in tissue lysates, tissue proteins (20 μg) were separated by 4% to 20% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS‐PAGE) and immunoblots were developed using the following antibodies: pSMAD3 (Abcam, 1:1000), SMAD3 (Abcam, 1:1000), AMPK (Abcam, 1:1000), tau (Thermo Fisher, 1:1000), pTauS199 (Thermo Fisher, 1:1000), pTauS202/T205 (Abcam, 1:1000), pTauS262 (Abcam, 1:1000), GSK3β (Abcam, 1:1000), pGSK3βS9 (Abcam, 1:1000), pGSK3βT216 (Abcam, 1:1000), APP (Abcam, 1:1000), BACE1 (Abcam, 1:1000), GAPDH (Santa Cruz Biotech, 1:1000), CTF‐β (Santa Cruz Biotechnology, Inc., 1:1000), Calbindin (Abcam, 1:1000), and GCPII (Thermo Fisher, 1:4000).
7
Western Blot Analysis of Signaling Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissues or cells were lysed using ice-cold lysis buffer (50 mM Tris—HCl, pH7.0, 1%w/v SDS, 10%glycerol) and were centrifugated at 4°C. Subsequently, proteins in the supernatants were quantified. After being separated by10% SDS PAGE, the proteins were blotted onto nitrocellulose membrane (Amersham BioSciences, Buckinghamshire, UK). After being blocked with 10% nonfat milk in PBS for 1 hour, the membranes were immunoblotted with antibodies as indicated. Then the membranes were immunoblotted by HRP-linked secondary antibodies (Cell Signaling). The signals were detected by SuperSignal West Pico Chemiluminescent Substrate kit (Pierce, Rockford, IL, USA). Anti-p-SMAD2, SMAD2, p-SMAD3, SMAD3, EGFR, TGF-β2 and IGFBP-3, and glyceraldehydes 3-phosphate dehydrogenate (GAPDH) antibodies were obtained from Abcam Company (USA). Enhanced chemiluminescence (ECL, Amersham Pharmacia Biotech) system was used to visualize intensity of the bands, which were subsequently exposed.
8
Syndecan-1 Regulation in TGF-β Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ovalbumin (OVA) and 4, 6-diamino-2-phenylindole dihydrochloride (DAPI) were purchased from Sigma-Aldrich (USA). The rabbit monoclonal antibodies SDC-1, p-Smad3, Smad3, and collagen I were prepared by Abcam (USA). Meanwhile, the rabbit monoclonal antibody GAPDH, HRP-conjugated goat anti-rabbit IgG, Alexa Fluor goat anti-rabbit, recombinant human TGFβ1, recombinant mouse SDC-1, and recombinant human SDC-1 were acquired from RD Biotechnology Ltd. Small interfering RNA targeting SDC-1 (SDC-1 siRNA), homo-SDC-1 in PCDNA3.1 (pc-SDC-1), and SDC-1 short hairpin RNA (SDC-1 shRNA) were synthesized by Gene Chem Co., Ltd. (Jinan, China).
9
Protein Expression Analysis in Kidney Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Proteins were extracted from kidney tissues according to standard protocols. In brief, protein samples were separated on 12.5% sodium dodecyl sulfate-polyacrylamide gel electrophoresis gels (40 μg/lane), and then were transferred to a nitrocellulose membrane (Bio-Rad). The membrane was blocked with 5% non-fat dry milk in TBS-T buffer, and then incubated with rabbit polyclonal anti-Bax (1:1000; Cell Signaling Technologies [CST], Danvers, MA, USA), Bcl-2 (1:1000; CST, CA), Caspase3 (1:1000; CST, CA), TGF-β1 (1:1000; CST, CA), HMGB1 (1:800; CST, CA), or Smad3 (1:2000; abcam, Cambridge, UK) antibody or mouse monoclonal anti-GAPDH antibody (1:1000; Santa Cruz, Dallas, TX, USA) overnight at 4°C. After extensive rinsing with TBS-T buffer, blots were incubated with HRP-conjugated anti-rabbit or anti-mouse secondary antibodies (Santa Cruz) and developed using an enhanced chemiluminescence system (ECL Kit; Pierce Biotechnology Inc., Rockford, IL, USA) and captured on light-sensitive imaging film (Kodak, Tokyo, Japan).
10
Molecular Signaling in Cisplatin-Induced Injury
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cisplatin and TGF-β1 (Sigma-Aldrich, St. Louis, MO, USA) were dissolved in PBS and 10 mM Citric Acid (pH 3.0), respectively. Small inhibitors LY294002, SB203580, U0126, SP600125 (SelleckChemicals, Houston, TX, USA) were dissolved in DMSO. Phospho-Akt (Ser473), phospho-Smad3 (Ser423/425), phospho-ERK (Thr202/Tyr204), Erk, phospho-p38 (Thr180/Tyr182), SAPK/JNK, phospho-SAPK/JNK (Thr183/Tyr185), p15INK4B, p21Waf1/Cip1, bax, bcl2, and ki67 were purchased from Cell Signaling Technology (Beverly, MA, USA). P38, pan-Akt, and β-Actin were purchased from Santa Cruz Biotechnology Inc (Santa Cruz, CA, USA). Smad3 and c-myc were purchased from Abcam Co Ltd (Cambridge, UK). Horse radish peroxidase (HRP) conjugated secondary anti-rabbit and antimouse IgG antibodies were from Sigma-Aldrich Co., Ltd.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!