Two steps of PCR were performed for the purified DNA samples to obtain sequence libraries. The first PCR was performed for amplification using a 16S (V3-V4) Metagenomic Library Construction Kit for NGS (Takara Bio Inc., Kusatsu, Japan) with primer pair 341F (5′-TCG GCA GCG TCA GAT GTG TAT AAG AGA CAG CCT ACG GGN GGC WGC AG-3′) corresponding to the V3-V4 region of the 16S rRNA gene. The second PCR was performed to add the index sequences for the Illumina sequencer with a barcode sequence using the Nextera XT Index Kit (Illumina, San Diego, CA). The prepared libraries were subjected to sequencing of 250 paired-end bases using the MiSeq Reagent Kit v.3 on the MiSeq (Illumina) at Takara Bio. Processing of sequence data, including operational taxonomic unit (OTU) definition, taxonomy assignment, and an OTU BLAST search were performed using CD-HIT-OTU 0.0.1, QIIME ver. 1.8, and the DDBJ 16S rRNA database, respectively.
16s v3 v4 metagenomic library construction kit for ngs
Manufactured by Takara Bio
Sourced in Japan
The 16S (V3-V4) Metagenomic Library Construction Kit for NGS is a laboratory product designed for the construction of 16S ribosomal RNA gene libraries for next-generation sequencing (NGS) analysis. The kit provides the necessary reagents and protocols to amplify the V3-V4 hypervariable regions of the 16S rRNA gene, which are commonly used for taxonomic identification of microbial communities.
Automatically generated - may contain errors
Lab products found in correlation
Nextera xt index kit, by Illumina (8 mentions)
Miseq reagent kit v3, by Illumina (8 mentions)
Nucleospin microbial dna kit, by Macherey-Nagel (2 mentions)
Miseq system, by Illumina (2 mentions)
Miseq platform, by Illumina (2 mentions)
Phix control kit v3, by Illumina (1 mentions)
Ampure xp magnetic beads, by Beckman Coulter (1 mentions)
Miseq reagent kit v2, by Illumina (1 mentions)
Ampure xp bead, by Beckman Coulter (1 mentions)
Qiaamp fast dna stool mini kit, by Qiagen (1 mentions)
Quant it dsdna assay kit, by Thermo Fisher Scientific (1 mentions)
Nextera xt index kit v2, by Illumina (1 mentions)
Nucleospin soil kit, by Macherey-Nagel (1 mentions)
Agencourt ampure xp, by Beckman Coulter (1 mentions)
11 protocols using 16s v3 v4 metagenomic library construction kit for ngs
1
16S rRNA Sequencing Workflow for Microbial Profiling
2
16S rRNA Sequencing for Microbial Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two steps of PCR were used for the purified DNA samples to obtain sequence libraries. The first PCR was performed for amplification using a 16S (V3-V4) Metagenomic Library Construction Kit for NGS (Takara Bio Inc.) with primer pair 341F (5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGC AG-3') and 806R (5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3'), corresponding to the V3-V4 region of the 16S rRNA gene. N, W, H and V were mixed base codes (N for A, C, G, T; W for A, T; H for A, C, T; V for A, C, G). The accession number of the gene used in designing primers was Gene ID 948332 (rrsA, Escherichia coli str. K-12 substr. MG1655; https://www.ncbi.nlm.nih.gov/gene/?term=948332 ). These pair primers are universal primers in popular use (8 (link),9 (link)). The second PCR was performed to add the index sequences for the Illumina sequencer with a barcode sequence using the Nextera XT Index Kit (Illumina, San Diego, CA). The prepared libraries were subjected to sequencing of 250 paired-end bases using the MiSeq Reagent Kit v.3 on the MiSeq (Illumina) at Takara Bio. In processing of sequence data, operational taxonomic unit (OTU) definition, taxonomy assignment, and an OTU BLAST search were performed using CD-HIT-OTU 0.0.1, QIIME ver. 1.8, and the DDBJ 16S rRNA database, respectively.
3
16S rRNA Gene Amplicon Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two-step polymerase chain reactions (PCRs) were performed for the purified DNA samples to obtain sequence libraries. The first PCR was performed to amplify and used a 16S (V3–V4) metagenomic library construction kit for NGS (Takara Bio Inc, Kusatsu, Japan) with primer pairs 341F (50-TCGTCGGCAGCGTCAGATGTGTATAAGA GACAGCCTACGGGNGGCWGCAG-30) and 806R (50-GT CTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGA CTACHVGGGTWTCTAAT-30) corresponding to the V3–V4 region of the 16S rRNA gene. The second PCR was performed to add the index sequences for the Illumina sequencer with a barcode sequence using the Nextera XT index kit (Illumina, San Diego, CA, USA). The prepared libraries were subjected to sequencing of 250 paired-end bases using the MiSeq Reagent v3 kit and the MiSeq (Illumina) at the Biomedical Center at Takara Bio.
4
16S rDNA Amplification and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The specimens were stored at − 20 °C until DNA extraction. Bacterial DNA was extracted using the NucleoSpin Microbial DNA kit (MACHERY-NAGEL, Düren, Germany) according to the manufacturer’s instructions. The total DNA was eluted in 50 μL of elution buffer and was stored at − 20 °C. The V3–V4 hypervariable regions of 16S ribosomal DNA (rDNA) were amplified using the 16S (V3–V4) Metagenomic Library Construction Kit for NGS (Takara Bio Inc., Kusatsu, Japan) with primer pairs (341F 5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3′, 806R 5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3′). The amplicon was purified using AMPure XP magnetic beads (Beckman Coulter, Brea, CA, the USA). The index PCR was performed using the Nextera XT Index Kit (Illumina, San Diego, CA, the USA). After purification with AMPure XP beads, sequencing was conducted on a MiSeq platform with the MiSeq Reagent Kit v3 and Phix Control Kit v3 (Illumina) from Takara Bio Inc.
5
16S rDNA Amplicon Sequencing of Mouse Gut Microbiome
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from mouse faeces using the NucleoSpin Microbial DNA kit (Machery Nagel, Düren, Germany) and purified with the Agencourt AMPure XP PCR system (Beckman Coulter, Beverly, MA, USA). A multiplexed amplicon library covering the 16S rDNA (V3-V4) region was generated from extracted DNA samples using the 16S (V3-V4) Metagenomic Library Construction Kit for NGS (TaKaRa Bio) following the manufacturer’s protocol and purified again with the AMPure XP system. The Illumina Miseq platform (Illumina Inc., San Diego, CA, USA) was used to generate 250-bp paired-end sequences. The obtained sequence data are available in the DNA Data Bank of Japan (http://www.ddbj.nig.ac.jp/ ) under accession number DRA005604 and DRA006060. A total of 2,031,033 sequence reads were generated, corresponding to an average of 126939.6 (range, 90,723–180,451) reads per sample. Noise, low quality sequences, pyrosequencing errors, and chimeras were removed from the data set. The preprocessed reads were clustered into OTUs at 97% identity using the CD-HIT-OTU pipeline (http://weizhongli-lab.org/cd-hit-otu/ , ver. 0.01)56 (link).
6
16S rRNA Gene Sequencing for Microbiome Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sequencing libraries were constructed as described previously [40 (link)]. Briefly, the V3-V4 regions of the 16S rRNA gene were amplified using a 16S (V3–V4) Metagenomic Library Construction Kit for NGS (Takara Bio Inc., Kusatsu, Japan). The following primers were used (16S rRNA gene-specific sequences are underlined): 341F with overhang adapter 5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG -3′ and 806R with overhang adapter 5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT -3′. The second PCR was performed using the Nextera® XT Index Kit (Illumina, San Diego, CA, USA) for sample multiplexing with index adapters. The libraries were sequenced on the MiSeq™ platform using the MiSeq™ Reagent Kit v3 (2 × 250 bp; Illumina).
7
16S rRNA Sequencing of Microbial Communities
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A two-step polymerase chain reaction (PCR) was performed on the purified DNA samples to obtain sequence libraries. The first PCR was performed to amplify, and a 16S (V3–V4) metagenomic library construction kit for NGS (Takara Bio Inc., Kusatsu, Japan) was used with primer pairs 341F (5′- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3′) and 806R (5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3′) corresponding to the V3–V4 region of the 16S rRNA gene. The second PCR was performed to add the index sequences for the Illumina sequencer with a barcode sequence using the Nextera XT Index Kit (Illumina, San Diego, CA, USA). The prepared libraries were subjected to sequencing of 250 paired-end bases using the MiSeq Reagent v2 Kit and MiSeq (Illumina) at the Biomedical Center of Takara Bio, Japan.
8
Microbiome Analysis by 16S rRNA Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Microbiome analysis was performed according to the previous reports.(22 (link),23 (link)) Briefly, the QIAamp Fast DNA Stool Mini Kit (Qiagen, Valencia, CA) was used to extract genomic DNA from the collected fecal pellets. Microbiome analyses by 16S rRNA gene sequencing were conducted by Takara Bio Inc. DNA specimen from feces was amplified using a 16S (V3–V4) metagenomic library construction kit for NGS (Takara Bio Inc., Kusatsu, Japan) with primer pairs 341F (5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGTCTCGTGGGCTCGG -3') corresponding to the V3–V4 region of the 16S rRNA gene. The amplicons were purified and prepared for the sequencing library by using AMPure XP beads (Beckman Coulter, Brea, CA). The purified amplicon library was sequenced on an Illumina Miseq platform (Illumina Inc., San Diego, CA) at the Biomedical Center at Takara Bio. The processing of sequence data, including chimera check, operational taxonomic unit (OTU) definition, and taxonomy assignment, was performed using QIIME 2,(24 (link)) DATA2,(25 (link)) and VSEARCH.(26 (link))
9
Targeted 16S rRNA Microbiome Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA extraction from the samples, preparation of a 16S rRNA library, and sequencing were conducted at Takara Bio, Inc (Kusatsu, Japan) using the MiSeq system (Illumina, San Diego, Calif) according to the manufacturer's protocol. DNA was extracted from the samples using the NucleoSpin Soil kit (Macherey-Nagel, Düren, Germany). All extracted DNA samples were quantified by fluorescence detection using the Quant-iT dsDNA Assay Kit (Thermo Fisher Scientific, Waltham, Mass) and purified using Agencourt AMPure XP (Beckman Coulter, Brea, Calif). Sequencing libraries were prepared using the 16S (V3-V4) Metagenomic Library Construction Kit for NGS (Takara Bio, Kusatsu, Japan). The first polymerase chain reaction amplification was performed using the primer pair 341 F (5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3′) and 806 R (5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3′) with Illumina adaptor overhang sequences. The second polymerase chain reaction amplification was performed using the Nextera XT Index Kit v2 (Illumina). Sequencing libraries were purified using Agencourt AMPure XP (Beckman Coulter) and quantified by fluorescence detection using the Quant-iT dsDNA Assay Kit (Thermo Fisher Scientific). Clonal clusters of the libraries were generated and sequenced on a MiSeq system (Illumina) with the MiSeq Reagent v3 kit (Illumina) in the 2 × 250-bp mode.
10
Two-step PCR for 16S rRNA Metagenomics
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two-step polymerase chain reaction (PCR) was performed to generate sequence libraries of the purified DNA samples. The first PCR was performed to amplify the DNA samples using a 16S (V3–V4) metagenomic library construction kit for NGS (Takara Bio Inc, Kusatsu, Japan). The primer pair for the first PCR included the 341F forward primer (5’-TCGTCGGCAG CGTCAGATGT GTATAAGAGA CAGCCTACGG GNGGCWGCAG-3’) and 806R reverse primer (5’-GTCTCGTGGG CTCGGAGATG TGTATAAGAG ACAGGGACTA CHVGGGTWTC TAAT-3’) that corresponded to the V3-V4 region of the 16S rRNA gene. The second PCR was performed using a Nextera XT index kit (Illumina, San Diego, CA, USA) to add the index sequences for the Illumina sequencer with a barcode sequence. The prepared libraries were then subjected to sequencing of 250 paired-end bases at the Biomedical Center at Takara Bio using a MiSeq Reagent v3 kit and the MiSeq system (Illumina).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!