Hindiii

As positive controls we used the five major Ehrlichia spp., mainly E. ruminantium, E. canis, E. chaffeensis, E. ewingii and E. muris. We also tested Ehrlichia that were available to us and have been previously reported to occur in ruminants, mainly E. ovina [4 (link)], Ehrlichia sp. BOV2010 [13 (link)] and the Panola Mountain Ehrlichia [9 (link)]. We used DNA extracted in previous studies from E. ruminantium [10 (link)] and E. canis [20 (link)], DNA extracted as described below from tissue cultures of E. canis (Oklahoma) and E. chaffeensis (Arkansas) (supplied by Gregory Dasch, Centers for Disease Control, Atlanta), from blood stabilates (E. ovina and Ehrlichia sp. BOV2010), and from an Amblyomma variegatum positive for the Panola Mountain Ehrlichia by PCR (unpublished data). We also used plasmids that were created to contain an appropriate portion of the 16S rRNA gene of E. ewingii and E. muris using the pIDTSMART cloning vector (Integrated DNA Technologies, Coralville, IA, USA) and linearization with HindIII (Promega, Madison, WI, USA).
To test the specificity of our PCR, we tested DNAs extracted from blood of cattle verified to be infected with A. marginale (identical nucleotide 16S rRNA sequences with CP006847) and A. phagocytophilum (identical 16S rRNA sequences with KJ782389).

The C4 promoter region was PCR amplified from human genomic DNA via full length-forward and reverse primers (Table 1). Then, the PCR product was cloned into pGEM-T-Easy vector (Promega, Madison, WI, United States). A single clone of C4 promoter was identified and digested by XhoI and HindIII (Promega). The C4 promoter was then subcloned into reporter gene vector pGL4.19 basic (Promega) at the XhoI and HindIII restriction sites to generate pC4-1,007/+44. To generate the 5’-deletion constructs, pC4-119/+44, pC4-102/+44, pC4-92/+44, pC4-72/+44, and pC4-48/+44, genomic DNA fragments were PCR amplified from the pGL4.19 plasmid using forward (segment 1 to segment 5) and reverse primers (Table 1). Then, the PCR product was digested by HindIII and XhoI, and subcloned into pGL4.19 basic.

Genomic DNA (1 μg/μL) of each bacteriophage was digested individually with EcoRI, HaeIII, HindIII, and SalI restriction enzymes (Promega, United States) according to the manufacturer’s protocols and incubated at 37°C for 1 h. The digested product was electrophoresed and visualized as mentioned in the above section.

As it was previously described for SLPI^{32 (link)} cementoin mRNA was extracted from HeLa cells (epitheloid cervix carcinoma) and reverse-transcribed to cDNA using oligo-dT primers with MMLV-RT (Promega, Madison, WI) according to specifications of the manufacturer. Two pairs of modified PCR primers (forward primer GTTCTACATATGGCTGTCACGGGAGTT and reverse primer TTAAAGGTCAAGATAAAGTCAAAAAGCTT) were used to generate the complete open reading frame of the cementoin peptide from the obtained cDNA. The SLPI and cementoin cloned genes were amplified by PCR with modified primers, these primers created new recognition sites for restriction enzyme and an ATG (Met) translation initiation codon on the 5′ end. The plasmids, pGEMT-SLPI and PGEMT-cementoin were digested with the restriction enzimes ApaI and HindIII (Promega, Madison, WI) and cementoin and SLPI fragments were incubated together in equimolar amounts in a ligation reaction with the enzyme T4 DNA ligase (Promega). This insert was then ligated to the pET22b⁺expression vector (Stratagen).
The pET-Cementoin-SLPI vector was purified and electroporated in the E. coli expression strain Origami (Novagen, Inc., an Affiliate of Merck KGaA, Darmstadt, Germany). Origami host strains have mutations in both the thioredoxin reductase (trxB) and glutathione reductase (gor) genes, which greatly enhance disulfide bond formation in the cytoplasm.

The M2e-NP fusion gene (1617 bp) was cloned into yT&A cloning vector (Yeastern Biotech, Taipei, Taiwan) and multiplied in E. coli strain TOP 10. The yT&A-M2e-NP plasmid and pRSET B vector were digested with BamHI (Promega, USA) and HindIII (Promega, USA). The digested products were ligated at 1:3 molar ratio (pRSET B: M2e-NP) using T4 DNA ligase (Fisher Scientific, USA). The ligation mixture (5 μL) was added into 100 μL of E. coli strain Top 10, and then incubated at 45 °C for 90 s. About 100 μL of Luria Bertani (LB) broth (Thermofisher, Waltham, MA, USA) was added into the mixture, and incubated at 37 °C on a shaker for 45 min. On LB bacterial agar (Thermofisher, USA), 100 μL of culture was plated using a spreader. The plate was incubated overnight at 37 °C. Bacterial colonies were selected randomly and screened by using PCR. pRSET B-M2e-NP (Figure 1) was isolated and sequenced to confirm the presence of M2e-NP fusion gene and its nucleotide sequence.