Ampure beads

NGS was performed using the Ion Torrent platform (Life Technologies), according to the manufacturer’s specifications. An Ion Torrent adapter-ligated library was constructed with the Ion AmpliSeq Library Kit 2.0 (Life Technologies) following the manufacturer’s protocol. Briefly, 10 ng of pooled amplicons were end-repaired, and DNA ligase was used to ligate Ion Torrent adapters P1 and A. The adapter-ligated products were purified with AMPure beads (Beckman Coulter), and the purified products were nick-translated and PCR-amplified for a total of 5 cycles. The resulting library was again purified with AMPure beads, and the size and concentration of the library were determined by Agilent 2100 Bioanalyzer and Agilent Bioanalyzer DNA High-Sensitivity LabChip (Agilent Technologies).

The amplification protocols and primers were done as per the Earth Microbiome Project (http://www.earthmicrobiome.org/). Genomic DNA was amplified using 16S rRNA gene primers 515F (GTGCCAGCMGCCGCGGTAA) and 806R (AGTCAGTCAGCCGGACTACHVGGGTWTCTAAT), and 18S rRNA gene primers 1391F (GTACACACCGCCCGTC) and EukBr (TGATCCTTCTGCAGGTTCACCTAC) (74 (link)) and the mammal blocking primer designed as described by Vestheim and Jarman (75 (link)). Unique Golay barcodes used in 16S and 18S rRNA gene analyses for multiplexing were linked to the reverse primer and are presented in Tables S2 and S3, respectively, in the supplemental material. Each sample was amplified in triplicate along with extraction and PCR controls. Once the negative controls were confirmed free of contamination, the 3 replicates of each sample were combined and purified using AMPure beads (catalog no. A63881; Agilent Technologies, Santa Clara, CA), per the manufacturer's protocol. The samples were tested on Agilent 2200 TapeStation D1000 ScreenTapes (Agilent Technologies) for the presence of the correct size bands and quantified using the Quant-iT double-stranded DNA (dsDNA) assay kit (catalog no. Q33120; Invitrogen-Thermo Fisher, Waltham, MA). Quantified libraries were individually normalized to 4 nM, and equal amounts of each 4 nM dilution were pooled for sequencing.

ATAC-Seq libraries were generated using OMNI-ATAC to reduce mitochondrial reads (Araujo et al., 2011 (link)). Briefly, 50,000 purified UCB monocytes were stimulated with 1 µg/mL LPS for 16 hr before being lysed in lysis buffer (10 mM Tris-HCl (pH 7.4), 10 mM NaCl, 3 mM MgCl₂), for 3 min on ice to prepare the nuclei. Immediately after lysis, nuclei were spun at 500 g for 10 min to remove the supernatant. Nuclei were then incubated with a transposition mixture (100 nM Tn5 transposase, 0.1% Tween-20, 0.01% Digitonin, and TD Buffer) at 37 °C for 30 min. Transposed DNA was then purified with AMPure XP beads (Beckman Coulter) and partially amplified for five cycles using the following PCR conditions - 72 °C for 3 min; 98 °C for 30 s and thermocycling at 98 °C for 10 s, 63 °C for 30 s, and 72 °C for 1 min. To avoid overamplification, qPCR was performed on 5 µL of partially amplified library. Additional cycles of amplification for the remainder of the sample were calculated from the saturation curves (cycles corresponding to a third of the saturation value). Fully amplified samples were purified with AMPure beads and quantified on the Bioanalyzer (Agilent Technologies, Santa Clara CA). Libraries were sequenced on the HiSeq4000 platform (Illumina, San Diego CA).