Effectene transfection kit

Drosophila S2-Gal4 cells were maintained at 26°C either in Schneider media (Gibco/Life Technology, Grand Island, NY, USA) containing 10% Fetal Bovine Serum (FBS), or serum free media (SFM). Constructs were made using Gateway cloning with clonase (Invitrogen/Life Technology, Grand Island, NY, USA) and transfected using the Effectene transfection kit (Qiagen, Valencia, CA, USA). Transfections were conducted with one or more Gateway pT.UAS constructs [GFP-Rac1G12V (Rac1^CA), GFP-Rho1G14V (Rho1^CA), GFP-Cdc42G12V (Cdc42^CA), GFP-Rac1T17N (Rac1^DN), GFP-Rho1T19N (Rho1^DN), GFP-Cdc42T17N (Cdc42^DN), Flag-RhoGAP18B-PC (PC), Flag-RhoGAP18B-PD (PD), HA-RhoGAP18B-PA (PA)] depending on the experiment. Anti-PC, anti-PD and anti-PA RNAi was generated using the Megascript T7 kit (Ambion/Life Technology, Grand Island, NY, USA) from pENTR gateway cloned constructs made with isoform specific primers and cells were treated daily with 5mg dsRNAi for three days. RNAi primers PC+ (CCAAAGAGCGTACCAGCGCGCGATCC); PC- (CAACCACCGATCAACGGTTATCGGCGA); PD+ (GCTCTCCAAGCGGCGGCGG); PD- (AACCACCAGCACAACCCCACGCCG); PA+ (ATGGCCGGCGATACGGA); PA- (ATGCTGGATCTGACCTCCAACCAT); GAP+ (GATGACAAGAAGTCCATCAAG); GAP- (GTTCCACGTTTCGTGGTC).

The pri-miR-550-1 sequence was amplified by PCR from healthy human BM mononuclear cells (MNCs). Primers with mutated sequences (Table 1) were then used to generate the indicated mutant miR-550-1 template, and these wild type (WT) and mutant miR-550-1 sequences were thereafter cloned into the MSCV-PIG vector (MSCV-Puromycin-IRES-GFP vector) (Cold Spring Harbour Laboratory, USA) in order to overexpress these two miRNA isoforms. These sequences were inserted between the XhoI (CTCGAG) and EcoRI (GAATTC) sites in this vector. For WWTR1-CDS vectors, the WT sequence was amplified from healthy human BM MNCs prior to insertion into the pCDH vector (SBI, Mountain View, USA). The MSCVneo-MLL-AF9 plasmid was kindly provided by Dr. Scott Armstrong.
One day prior to transfection, 5 ×10⁵ HEK293T cells were plated into 60-mm dishes. Retroviruses were then produced via transfecting cells with vector DNA and a packaging vector (PCL-Eco or PCL-Ampho) with the Effectene Transfection Kit (Qiagen). The WWTR1 overexpressing lentivirus was generated via co-transfection of the WWTR1-pCDH plasmid and packaging lentivirus vectors (pRSV-Rev, pMDLg/pRRE and pMD2.G). At 48 and 72 h post-transfection, cellular supernatants were harvested and filtered through a 0.45 μm cellulose acetate filter prior to storage.

For the assay with purified proteins, five micrograms each of purified DENV-2 E and AaHig were incubated at 4°C for 2 hrs. Subsequently, 1 μg of baited antibody was added to pull down the protein complex. For the experiment with cell supernatant/lysate, the recombinant plasmids were transiently transfected into Drosophila S2 cells with an Effectene transfection kit (Qiagen, Cat. No# 301425). The cell supernatant/lysate was incubated with purified protein overnight at 4°C for the pull-down assay. To investigate the interaction between AaHig and DENV virions in the infected cells, pAc-AaHig was transfected in mosquito Aag2 cells, and subsequently the cells were infected by 5 M.O.I. DENV-2 at 12 hrs post transfection. The uninfected cells transfected by pAc-AaHig were used as a mock control. After 48 hrs infection, the cells were lysated and an anti-flaviviral E 4G2 mAb was added into the lysate for the pull-down assay. The experimental details are described in the Pierce Classic IP kit product manual (Thermo Scientific, Cat. No# 26146).

The pNL luc-AM vector described by Pugach et al. [56 (link)] was cotransfected along with one of each pREC env clonal plasmid (thirty for each dual tropic isolate) into 293T cells using effectene transfection kit (Qiagen, Valencia, CA, USA). Pseudovirus-containing supernatants were harvested from each well at 72 h post transfection and then used to infect both U87.CD4.CCR5 and U87.CD4.CXCR4 cells in triplicate. After 72 h at 37°C in 5 % CO₂, the supernatant was removed and cells were washed with 200 μl of phosphate buffered saline (PBS, Cellgro). 100 µl of cellgro lysis buffer was added to lyse the cells. 50 µl of the Luciferin Steady Glo substrate was added to 50 µl of lysate supernatant to measure luciferase activity.

Drosophila S2 cells were transfected with double-strand RNAs using the bathing method described in [19 (link)] or with plasmids using the Effectene transfection kit (Qiagen). HeLa cells were transfected with siRNA using Lipofectamine RNAiMax Transfection Reagent (Invitrogen). THP1 cells were transfected with siRNA using Lipofectamine 3000 Transfection Reagent (Invitrogen).

Cells seeded in MatTek dishes were transfected at 60–70% confluency using the Qiagen Effectene transfection kit with some modifications to the protocol. First, 800 ng of DNA was incubated with 3 µL of Enhancer and 100 µL of DNA-condensation buffer (buffer EC) for 15 min rather than the recommended 2–5 min, followed by the addition of 5 µL of Effectene and incubation for 20 min rather than the recommended 5–10. Subsequently, the transfection reagent was added to the cells and cells were left to incubate At 37°C with 5% CO₂ overnight before imaging the following day.