Hiscript 2 supermix

Freshly collected endometrial tissue from the implantation stage was transferred to a culture dish, cut into pieces, and digested with collagenase at 37 °C for 30 min. The digestate was filtered using a filter to remove endometrial stromal cells and obtain primary endometrial epithelial cells. Total RNA was extracted from the samples. The isolated RNA (500 ng) was reverse-transcribed into complementary DNA using the HiScript II SuperMix (Vazyme, Beijing, China). qRT-PCR analysis was performed using the SYBR green master mix with the ABI 7500 System (Thermo Fisher Scientific, Waltham, MA, USA). The PCR conditions were as follows: 46 cycles of 94 °C for 10 min, 94 °C for 10 s, and 60 °C for 45 s. GAPDH was used as an internal reference.

Total RNA was isolated from cells, sEVs, and tissue using TRIzol reagent (Invitrogen). Then cDNA was synthesized from at least 1 μg of RNA using the HiScript II SuperMix (Vazyme Biotech Co., Ltd., China). Quantitative polymerase chain reaction (qPCR) was carried out with a QuantStudio 6 Flex Real-Time PCR System (Life Technologies, Carlsbad, CA) using SYBR Premix ExTaq (Vazyme Biotech Co., Ltd., China) and gene-specific primers (Table S1). The data were analyzed using the 2^−ΔΔCT method, with Actin as internal control.

Total RNAs of decidua tissues were extracted using Trizol (Invitrogen) according to manual instructions. Quantitative RT-PCR (qRT-PCR) was performed using the HiScriptII Supermix (Vazyme, Nanjing, China) following the manufacturer’s instructions. Briefly, RNA was quantified using a Nanodrop One instrument (Thermo, MA, USA) and 1 μg was used for reverse transcription using random primers. For qRT-PCR, SYBR Green master mix and primers (final concentration at 200 nM) were used and results were analyzed in CFX Connect PCR detection system (Bio-Rad, CA, USA). Primers were designed according to a previous publication (22 (link)) for CCL8 and GAPDH, or using an open resource (www.ncbi.nlm.nih.gov/tools/primer-blast) for TRDV1, TRDV2, and TRDV3, whose sequences are listed in Supplementary Table S2. Expression levels were normalized to GAPDH and represented as fold change compared to the control (2^−ΔΔCt).

The total RNA from GM12878, THP-1 and U937 cell lines (Thermo Fisher, USA) was extracted using TRIzol reagent. cDNA was created from 500 ng of RNA using the HiScript II SuperMix (Vazyme, China). By applying the SYBR Green Master Mix, RT-qPCR was carried out in ABI 7500 System (Thermo Fisher, USA). 45 cycles of 94 °C for 10 min, 94 °C for 10 s, and 60 °C for 45 s each comprised the PCR amplification conditions. Table 1 displayed the list of the sequences of primer pairs for targeted genes.Table 1

The primers of genes

Genes	Forward primer sequence (5’-3’)	Reverse primer sequence (5’-3’)
CD83	AAGGGGCAAAATGGTTCTTTCG	GCACCTGTATGTCCCCGAG
NRIP1	GGATCAGGTACTGCCGTTGAC	CTGGACCATTACTTTGACAGGTG
ACSL1	CCATGAGCTGTTCCGGTATTT	CCGAAGCCCATAAGCGTGTT
METTL7B	GCAACCGCAAGATGGAGAG	GATTTGGGTCTAGGCAGGTGA
OGT	TCCTGATTTGTACTGTGTTCGC	AAGCTACTGCAAAGTTCGGTT
C4orf48	CGTCCGAATGGGCGTTTTC	TGCATGAACTCGAAGGCGT
GAPDH	AATGGGCAGCCGTTAGGAAA	GCCCAATACGACCAAATCAGAG

TRIzol (Thermo Fisher, United States) reagent was used to extract the total RNA from Hep3B, Huh-7, and THLE-2 cell lines. cDNA was created from 500 ng of RNA using the HiScript II SuperMix (Vazyme, China). The PCR amplification conditions comprised 46 cycles of 94°C for 10 min, 94°C for 10 s, and 60°C for 45 s. GAPDH acted as the internal reference. The primer sequences for target genes are listed in Table 2.