Cdna reverse transcription kit

Total RNA was isolated from the TGF-β1-transduced chondrocyte-atelocollagen mixture beads, which were cultured in chondrogenic differentiation media for 3 weeks using the RNeasy mini kit (Qiagen, Valencia, CA). Isolated RNA (1 μg) was translated into cDNA using the cDNA reverse transcription kit (Qiagen). The mRNA expression level of type II collagen (COL2A1), aggrecan, and SOX9 was observed with glyceraldehyde-3-phosphate dehydrogenase serving as a housekeeping gene. The sequences of the primers employed for real-time quantitative polymerase chain reaction (RT-qPCR) are listed in Table 1.
Type II collagen, aggrecan, and SOX9 were examined using RT-qPCR with GoTaq qPCR Master mix (Promega, Madison, WI). The following thermal protocol was used: 95°C for 3 min, followed by 37 cycles of 15 s at 95°C and 30 s at 60°C, and melting curve analysis was performed at the last cycle. Each sample was processed in triplicate. The average ΔCt value of the triplicates was calculated. Relative expression levels for each primer set were expressed as fold changes using the 2-ΔΔCt method.

For the measurement of MMP2 and MMP9 mRNA expression, RT-qPCR was conducted in this study. Total RNA was extracted from the ischemic cerebral cortex hemisphere using TRIzol reagent (Invitrogen, Shanghai, China). Subsequently, the extracted mRNA was subjected to reverse transcription to generate cDNA, which was performed using the cDNA Reverse Transcription kit (Qiagen, USA) following the manufacturer's instructions. Amplification of the cDNAs was achieved using the miScript SYBR Green PCR Kit (Qiagen) as per the manufacturer's guidelines. The primer sequences used for MMP9 were as follows: forward primer 5′- AGGTGCCTCGGATGGTTATCG −3′ and reverse primer 5′- TGCTTGCCCAGGAAGACGAA −3′. The primer sequences for MMP2 were: forward primer 5′- AAAGGAGGGCTGCATTGTGAA −3′ and reverse primer 5′- CTGGGGAAGGACGTGAAGAGG −3′. To determine the relative expression levels of MMP2 and MMP9, the 2^−ΔΔCt method was employed, with GAPDH serving as the internal reference gene.

Aortas were frozen in liquid nitrogen and aortic RNA was isolated with Trizol® Reagent (Invitrogen; Carlsbad, CA, USA n = 5–7 mice/group). Concentration was determined with a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Inc., Wilmington, DE, USA) and purity was checked by the A260/A280 ratio (ratios between 1.8 and 2.1 were considered acceptable). cDNA was synthesized from 0.5 μg RNA with cDNA Reverse transcription kit (Qiagen). The resulting cDNA samples were amplified with a RT-PCR thermal cycler (Applied Biosystems Carlsbad, CA, USA 7900HT) and the following specific probes from CONDA: Lrp5 (Mm.PT.49a.8045420), Lrp1 (Mm.PT.49a.7750137), Lrp2 (Mm.PT.49a.11916154), Lrp6 (Mm.PT.56a.6383636), Lrp8 (Mm.PT.49a.6553055), Ldlr (Mm.PT.49a.9930556) and Cd36 (Mm.PT.49a.12111555). Vldlr (Mm00443298_m1) was purchased from Applied Biosystems. Results were normalized with 18S probe from Applied Biosystems.

Cultured cells or hippocampal samples were harvested, and total RNA was isolated using Trizol reagent (Invitrogen, San Diego, CA, USA). The RNA was used to generate cDNA using a cDNA Reverse Transcription Kit (QIAGEN, Waltham, MA, USA). Realtime PCR was carried out with TB Green Premix Ex Taq (Takara, Shiga, Japan). Results were obtained using the 2^−ΔΔCT method as described previously.^[41] Data were obtained from three separate experiments, each of which was performed in triplicate. Gene expression was normalized to GAPDH. Primer sequences are listed in Table S2, Supporting Information.

Total RNA was isolated using the Trizol reagent (Invitrogen, Carlsbad, CA, USA), and RNA quantity was assessed using Nanodrop (Agilent Technologies, California, USA). Then, cDNA was generated from 1 μg of total RNA per sample using the cDNA Reverse Transcription Kit (QIAGEN, Waltham, MA, USA). Quantitative PCR was performed using the primers listed in Table S1. Each sample was compared to GAPDH as the internal control. Data were recorded from three separate experiments, with each performed in triplicate.

To investigate the expression level of Faslg, total RNA was extracted using Trizol extraction reagent (Qiagen; CA, USA) and cDNA was synthesized using a cDNA Reverse Transcription Kit (Qiagen) according to the manufacturer’s protocol (Implen NanoPhotometer; Applied Biosystems^® 2720 Thermal Cycler). We performed real-time qPCR using a PCR system according to the manufacturer’s instructions (Applied Biosystems^® StepOnePlus™ Real-Time PCR System). The reactions were carried out in triplicate. We repeated these experiments three times and used the comparative cycle threshold method for analysis. The forward and reverse PCR primers used are presented in Table 4.