Quantitative real-time PCR for IFNα (n = 12), IFNβ, and IFNγ was carried out with the LightCycler 480 instrument (Roche, Basel, Switzerland). Briefly, total RNA was extracted from PBMCs and LPLs using the RNeasy Plus Universal Tissue Mini Kit (Invitrogen, Carlsbad, CA, USA) and reverse transcribed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA), according to the manufacturer's protocol. Primers and probes for each gene were added to the Probes Master Mix (Roche, Basel, Switzerland) at 500 and 250 nM, respectively, in a final volume of 20 μL. The housekeeping gene β-glucuronidase [11 (link)] was used as an internal control. Gene expression values were calculated by the comparative Ct method. The primers and probe were assayed on demand and were purchased from Integrated DNA Technologies (IDT), Iowa, USA. The list of primers and probes is as follows: IFNα1 (Hs.PT.58.46311748.g), IFNβ (Hs. PT.58.39481063.g), IFNα2 (Hs.PT.58.24294810.g), IFNα4 (Reference number: 68098028), IFNα5 (Hs.PT.58.39565646.g), IFNα6 (Hs.PT.58.40193986.g), IFNα7 (Hs.PT.58.25568785.g), IFNα8 (Hs.PT.58.40433689.g), IFNα10 (Hs.PT.58.24640720.g), IFNα14 (Reference number: 68098032), IFNα16 (Hs.PT.58.1479042.g), IFNα17 (Reference number: 68098036), IFNα21 (Hs.PT.58.45746476.g), and IFNγ (Hs.PT.58.3781960.g).
Rneasy plus universal tissue mini kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The RNeasy Plus Universal Tissue Mini Kit is a product designed for the isolation of total RNA from a wide variety of animal and plant tissues. It utilizes a silica-membrane technology to ensure efficient and reliable RNA purification.
Automatically generated - may contain errors
6 protocols using rneasy plus universal tissue mini kit
1
Quantitative real-time PCR for IFN expression
2
Quantitative Analysis of Cytokine Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time PCR for caspase-1, IL-1β, IL-8, IL-18 and IL-6 was carried out with the LightCycler 480 instrument (Roche, Basel, Switzerland). Briefly, at 6, 18 and 24 h.p.i., total RNA was extracted using the RNeasy Plus Universal Tissue Mini Kit (Invitrogen, Carlsbad, CA, USA). RNA extracts were reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Woburn, MA, USA), according to the manufacturer’s instruction. Primers and probes for each gene were added to the Probes Master Mix (Roche, Basel, Switzerland) at 500 and 250 nM, respectively, in a final volume of 20 μL. The housekeeping gene β-glucuronidase (GUS) was used as an internal control. GUS was selected as a good candidate for the housekeeping gene in our experimental setting, because it was constantly expressed in synovial cells after C. trachomatis or IFN stimulation. Gene expression values were calculated by the comparative 2−ΔCt methods. The primers and probe were assayed on demand and were purchased from Integrated DNA Technologies (IDT), Clear Creek, IA, USA. The list of primers and probes is as follows: IFNAR1: Hs.PT.58.20048943; IFNAR2: Hs.PT.58.1621113; IFNGR1: Hs.PT.58.20918191; IFNGR2: Hs.PT.58.38961914; IL-1β: Hs.PT.58.1518186; caspasi1: Hs.PT.59a.22997425.g; IL-6: Hs.PT.58.40226675; IL-18: Hs.PT.58.25675872; IL-8: Hs.PT.58.39926886.g.
3
Quantitative Real-Time PCR for IFN Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time PCR for IFN-α, IFN-β, and IFNR1 was carried out with the LightCycler 480 instrument (Roche, Basel, Switzerland). Briefly, total RNA was extracted from PBMCs and LPLs using the RNeasy Plus Universal Tissue Mini Kit (Invitrogen, Carlsbad, CA, USA) and reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystem), according to the manufacturer's protocol. Primers and probes for each gene were added to the Probes Master Mix (Roche, Basel, Switzerland) at 500 and 250 nM, respectively, in a final volume of 20 μL. The housekeeping gene β-glucuronidase [14 (link)] was used as an internal control. Gene expression values were calculated by the comparative Ct method. The primers and probe sequences used for IFN-α (Hs. PT.58.24294810.g), IFN-β (Hs. PT.58.39481063.g), and IFNR1 (Hs. PT.58.25402720.g) were purchased from Integrated DNA Technologies (IDT), Iowa, USA.
4
Quantitative PCR for IDO mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time PCR for IDO mRNA expression was carried out with the LightCycler 480 instrument (Roche, Basel, Switzerland). Briefly, total RNA was extracted from LPLs using the RNeasy Plus Universal Tissue Mini Kit (Invitrogen, Carlsbad, CA, USA) and reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystem, Foster City, CA, USA), according to the manufacturer’s protocol. Primers and probes for each gene were added to the Probes Master Mix (Roche, Basel, Switzerland) at 500 and 250 nM, respectively, in a final volume of 20 µL. The housekeeping gene β-glucuronidase was used as an internal control. Gene expression values were calculated by the comparative Ct method. The primers and probe sequences used for IDO were the following (Forward 5′-GCATTTTTCAGTGTTCTTCGCA-3′, Reverse 5′-CATACACCAGACCGTCTGATAGCT-3′, Probe5′-(6FAM) ATATTTGTCTGGCTGGAAAGGCAACCCC (TAM)-3′) [47 (link)].
5
Quantitative PCR for TLR Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time PCR for TLRs members (TLR2, TLR3, TLR4, TLR8, TLR9), was carried out with the LightCycler 480 instrument (Roche, Basel, Switzerland). Briefly, total RNA was extracted from respiratory samples using the RNeasy Plus Universal Tissue Mini Kit (Invitrogen, Carlsbad, CA, USA) and reverse transcribed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA), according to the manufacturer's protocol. Primers and probes for each
6
Quantitative Analysis of Immune Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mRNA levels of TLR9 (Hs.PT.58.40576968, Integrated DNA Technologies, IDT, Coralville, IA, USA), IFNα (Hs.PT.58.24294810.g, IDT), IFNβ (Hs.PT.58.39481063.g, IDT), and IFNε (Hs.PT.58.4812867.g, IDT) were measured by quantitative RT-Real time PCR assays carried out with the LightCycler 480 instrument (Roche, Basel, Switzerland) as previously described [30] (link). Briefly, total RNA was extracted from respiratory samples using the RNeasy Plus Universal Tissue Mini Kit (Invitrogen, Carlsbad, CA, USA) and reverse transcribed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA), according to the manufacturer's protocol. Primers and probes for each gene were added to the Probes Master Mix (Roche, Basel, Switzerland) at 500 and 250 nM, respectively, in a final volume of 20 μL. The housekeeping gene β-glucuronidase/GUS was used as an internal control. Gene expression values were calculated by the comparative cycle threshold value (Ct) method (2^-ΔCt).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!