Genomic DNA was extracted from iPSC clones using QuickExtract™ DNA extraction solution (Epicenter, WI, #QE09050). The targeted region of PCCB gene was amplified using Herculase Fusion Polymerase (Agilent, CA, #600675) with the primers listed in Table 3 . PCR amplicons were run on Novex 4%–20% TBE gels (ThermoFisher/Invitrogen, CA, #EC6225BOX) to identify INDELs (Fig. 1A ,B ). Deletions were confirmed within amplicons by DNA sequencing and loss of protein was confirmed by western blot. Nucleotide sequencing was performed by Retrogen Inc. The results were aligned using SnapGene and CLC sequence viewer software (Fig. 1C , D ).
Novex 4 20 tbe gels
Manufactured by Thermo Fisher Scientific
Sourced in Macao
Novex 4%–20% TBE gels are pre-cast polyacrylamide gels designed for the separation and analysis of proteins and nucleic acids. These gels feature a gradient of 4% to 20% polyacrylamide, which allows for the separation of a wide range of molecular weights. The gels are pre-cast in a Tris-Borate-EDTA (TBE) buffer system, which is commonly used in electrophoresis applications.
Automatically generated - may contain errors
Lab products found in correlation
Quickextract dna extraction solution, by Illumina (6 mentions)
Herculase fusion polymerase, by Agilent Technologies (6 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Geltrex coated, by Thermo Fisher Scientific (2 mentions)
Puromycin, by Merck Group (2 mentions)
Taq polymerase, by Merck Group (2 mentions)
6 protocols using novex 4 20 tbe gels
1
Identifying PCCB Gene Deletions in iPSCs
2
CRISPR-Mediated GATA6 Gene Editing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR guide RNAs (gRNAs) targeting exon 2 or 4 of the GATA6 gene were chosen based on previously published examples of successful GATA6 CRISPR/Cas9-based gene editing (Shi et al., 2017 (link); Tiyaboonchai et al., 2017 (link)). The guide RNA sequences (Table S7 ) were cloned into the PX459 pSPCas9(BB)-2A-Puro vector (Ran et al., 2013 (link)). GATA6+/+ K3 cells were seeded on to a Geltrex-coated (ThermoFisher/GIBCO, CA, #A1413302) 10cm2 tissue culture plate at 75% confluency. The following day, 30μg of the CRISPR/Cas9 plasmid with gRNA was introduced into the K3 pluripotent cells using Lipofectamine 3000 (ThermoFisher, CA, #L3000015), following the manufacturer’s protocol. After 24 hours, 1 μg/ml of puromycin (Sigma Aldrich, MO, #P9620) was supplemented into culture media for 48 hours. The surviving cell colonies were expanded and samples of each collected for analysis of genomic DNA using QuickExtract DNA extraction solution (Epicenter, WI, #QE09050). The CRISPR/Cas9 targeted regions were amplified using Herculase Fusion Polymerase (Agilent, CA, #600675) or Taq polymerase (Sigma Aldrich, MO, #11146173001) and run on Novex® 4%-20% TBE gels (ThermoFisher/Invitrogen, CA, #EC6225) to detect INDELs. Identified potential INDELs were confirmed by analyzing the amplicons using TIDE analysis and nucleotide sequencing (Brinkman et al., 2014 (link)).
3
CRISPR-Mediated GATA6 Gene Editing
4
Identifying PCCB Gene Deletions in iPSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from iPSC clones using QuickExtract™ DNA extraction solution (Epicenter, WI, #QE09050). The targeted region of PCCB gene was amplified using Herculase Fusion Polymerase (Agilent, CA, #600675) with the primers listed in Table 3 . PCR amplicons were run on Novex 4%–20% TBE gels (ThermoFisher/Invitrogen, CA, #EC6225BOX) to identify INDELs (Fig. 1A ,B ). Deletions were confirmed within amplicons by DNA sequencing and loss of protein was confirmed by western blot. Nucleotide sequencing was performed by Retrogen Inc. The results were aligned using SnapGene and CLC sequence viewer software (Fig. 1C , D ).
5
CRISPR-mediated gene editing in iPSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR guide RNAs targeting exon 4 of the DGUOK or exon 2 of RRM2B were designed following the protocol established by Zhang and colleagues (Ran et al., 2013 (link)). A guide sequence (catcgagtggcatatctatc) was cloned into PX459 pSPCas9(BB)-2A-Puro vector (Ran et al., 2013 (link)). The plasmid was introduced into SV20 cells by electroporation using a BTX electroporator. Electroporated iPSCs were cultured on Matrigel for 24 hours in the presence of ROCK inhibitor Y27632 (StemRD, CA, #146986-50-7) and then treated with 1 μg/ml Puromycin for two days. Cells that survived the selection were expanded until clones could be collected. Genomic DNA was extracted from the clones using QuickExtract™ DNA extraction solution (Epicenter, WI, #QE09050). The targeted regions of were amplified using Herculase Fusion Polymerase (Agilent, CA, #600675) and run on Novex® 4%–20% TBE gels (ThermoFisher/Invitrogen, CA, #EC6225BOX) to detect INDELs (DGUOK For: atcccacttccaaccaggtatatctttgc, Rev: ctggggagaagcctggaggtagatgaag; RRM2B For: acaggctctcaaaccaatgc, Rev: tctcagtaattccaacacttatcttc). Amplicons were cloned into plasmid and subjected to nucleotide sequencing to confirm the identity of the INDELs.
6
CRISPR-mediated gene editing in iPSCs
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!