Maldi tof

Primers were designed to detect single nucleotide polymorphisms (SNPs) in all exons and the 1,000-bp 5’ flanking region of MSRB3 (Table 1). Polymorphisms were analyzed using the DNAstar [10 (link)].
Genotypes at SNPs c.-735C > T and c.2571 T > C were determined for 370 F2 individuals of a Large White × Minzhu intercross population and 380 Beijing Black pigs using matrix-assisted laser desorption/ionization–time-off light mass spectrometry (MALDI-TOF, Sequenom, USA). Primers and probes used for MALDI-TOF were listed in Table 2. Genotype and allele frequencies were calculated for the two SNPs. Genotypic effects were analyzed by least-square analysis using the GLM procedure of SAS version 9.2, according to the following animal model:Table 2

Primers and probes used for genotyping

Polymorphism	Primer/probe	Sequence
c.-735C > T	M105F	5’ACGTTGGATGTATATGGAGTTGAGGCACGC3’
	M105R	5’ACGTTGGATGGGTGAAAAGAACGACTGACC3’
	Probe105	5’CTGACCTAGATAAAACATCAG3’
c.2571 T > C	M113F	5’ACGTTGGATGAGCCTGAGGTGAAACATCTG3’
	M113R	5’ACGTTGGATGACTCGTCATTGTCACATGGG3’
	Probe113	5’ACATTGTGCTCTTCCTCT3’

$\mathrm{Y}=\mathrm{\mu }+\mathrm{G}+\mathrm{S}+\mathrm{B}+\mathrm{W}+\mathrm{e}$
Where Y is the observation of ear size; μ is the population mean; G is the random effect of genotype; S is the fixed effect of sex; B is the fixed effect of the slaughter batch; W is the covariate effect of weight; and e is the random residue.

10 nl of the resultant cleavage reactions were spotted onto silicon matrix preloaded chips (Spectro-CHIP; Sequenom) using the MassARRAY nanodispenser (Sequenom) and analyzed using the MassARRAY Compact System matrix-assisted laser desorption/ionization-time-of-flight mass spectrometer (MALDI-TOF) (Sequenom). The spectra’s methylation ratios were calculated using EPITYPER software v1.0 (Sequenom). The method yields quantitative results for each of the sequence-defined analytic units referred as CpG units, which may contain either one individual CpG site or an aggregate of CpG sites. Triplicate independent analyses from sodium bisulfite-treated DNA samples were undertaken. The effectiveness of the entire experimental procedure was assessed by analyzing as control CpGenome Universal Unmethylated DNA (Chemicon, Millipore, Nuremberg, Germany) and CpGenome Universal Methylated DNA (Chemicon) in serial mixtures of methylated and unmethylated products, with 10% methylation increments. Data quality control and filtering were carried out by the removal of the CpG dinucleotides whose measurement success rate was <90%. Poor-quality and non-valuable data for the quantitative methylation of each CpG unit measured by MALDI-TOF-MS were excluded.

Genomic DNA was extracted from participants’ saliva samples. DNA extraction and genotyping were performed using the MALDI-TOF in the MassARRAY system (Sequenom Inc., San Diego, California, USA) according to the manufacturer’s instructions. The 5-HTTLPR polymorphism was amplified using the following primer sequences: forward 5’- GGCGTTGCCGCTCTGAATTGC-3’ and reverse 5’-GAGGGACTGAGCTGGACAACCCAC-3’. Genotype calling was performed with MassARRAY RT software 3.0.0.4 and analyzed using the MassARRAY Typer software 3.4.