Xfect polymer

Estimation of the needed siRNA concentration was carried out in UM27 cells. The concentrations 250 ng, 500 ng and 1000 ng of siJNK (Sigma-Aldrich, St. Louis, MO, USA; s: GUUCUUAUGAAAUGUGUUA[dT][dT], as: UAACACAUUUCAUAAGAAC[dT][dT]) were transfected twice, with 48 h intervals between the transfections. Scrambled siRNA (Sigma-Aldrich) of the same concentrations was used as a control. The concentration of 1000 ng of siJNK was used for further transfections. In short, nanoparticle complexes were prepared by adding Xfect Polymer (Takara, Shiga, Japan) to Xfect Reaction Buffer (Takara) containing the siRNAs and incubating the solution for 10 min at RT. The entire solution was added dropwise to the wells and gently mixed, before overnight incubation at 37 °C and 5% CO₂. The medium was refreshed the next day and the transfection was repeated after 48 h. Protection from lipid peroxidation was tested by addition of 100 nM of the ferroptosis inhibitor liproxstatin-1 (Lip-1) 1 h prior to transfection and continued supplementation in the medium.

Plasmid pSpCas9(BB)‐2A‐GFP (PX458) (kindly gifted from Feng Zhang, Addgene plasmid #48138) was used for generation of GFP‐labelled Cas9 vectors.20 In brief, the sgRNA oligos were ligated into pSpCas9(BB)‐2A‐GFP after digestion with restriction enzyme BbsI. These resulted vectors carried either guide RNA cr26 (GGCGGCGGAAGTTTCGGCGG, KRT10, exon 7) or cr33 (GCCTGCTAGAAGGAGAGGGA KRT10, exon 6). Plasmids were transfected with Xfect polymer (Takara Bio) as previously described.18 Briefly, 70 000 keratinocytes per well were seeded in 6‐well plates. One day later, a mixture of 660 ng of CRISPR/Cas9 plasmid, 0.2 µL Xfect polymer and 100 µL Xfect buffer was incubated at room temperature for 10 minutes and added to the keratinocytes. After 4 hours at 37°C, the medium was exchanged. Individual GFP‐fluorescent cells were FACSorted 72 hours later on an Aria II cell sorter (BD Biosciences) using 100 µm nozzle and 15 psi pressure. They were co‐cultivated with mouse 3T3‐J2 feeder fibroblasts (ATCC)21 previously arrested with 4 g L⁻¹ mitomycin C (StressMarq Biosciences) in 96‐well plates. Clones were subsequently expanded. Corresponding sequence data on KRT10 are summarized in Table S2.

The knockdown study was carried out using two different shRNA constructs targeting Linc01615 RNA, along with negative control vector scramble shRNA (Plasmid #1864, and gene). shRNA hairpin sequences were cloned in lentiviral mammalian expression vector pLKO.1 puro (Plasmid #8453, addgene). The sequence pairs for hairpins (target sequences are shown in bold) are: shRNA#1_1 5′-CCG​GAC​GTC​TGC​TAC​GAA​CTC​AAT​TCT​CGA​GAA​TTG​AGT​TCG​TAG​CAG​ACG​TTT​TTT​G-3’; shRNA#1_2 5′- AAT​TCA​AAA​AAC​GTC​TGC​TAC​GAA​CTC​AAT​TCT​CGA​GAA​TTG​AGT​TCG​TAG​CAG​ACG​T-3’; shRNA#2_1 5′- CCG​GCA​CTC​CCG​GAG​CAG​CAG​GAA​ACT​CGA​GTT​TCC​TGC​TGC​TCC​GGG​AGT​GTT​TTT​G-3’; shRNA#2_2 5′- AAT​TCA​AAA​ACA​CTC​CCG​GAG​CAG​CAG​GAA​ACT​CGA​GTT​TCC​TGC​TGC​TCC​GGG​AGT​G; Scramble shRNA sequence is 5′-CCT​AAG​GTT​AAG​TCG​CCC​TCG​CTC​GAG​CGA​GGG​CGA​CTT​AAC​CTT​AGG-3’. As per the manufacturer’s recommendation, all the transfections were carried out using Xfect polymer (TaKaRa Bio, cat.#631317). The transfected cells were selected using 2 μg/ml puromycin (Sigma, cat.#P8833) for a minimum of 48 h and used for RNA isolation using TRIzol reagent (Ambion, cat.#15596018), and 250 ng of total RNA was used to synthesize cDNA using iScript RT mix (Biorad, cat.#1708840). 20 ng of cDNA was used to perform the qPCR/semi-qPCR using universal SYBR Green mix (Biorad, cat.#1725271) or Emerald GT PCR mix (TaKaRa, cat.#RR310A).